Description :
From Genome Similarity Track
Location :
Scaffold_107:206241- 210195
Transcript NameFunction/comments
Physo_142052transposase
Physo_142053hypothetical protein

Sequence
3954 bases(100 bases per row)
TCCGGTGCCTCGAGGCGGTCGACCTGGCCAGCCGTGTGTACAAATGTATACACGCTGGTATGGATCTATGAAAGCAGGTAGCTTATCAATTTTGCCGAGC
TTGTACTTCTCAGTAACTACAATCCTGTCGTTGCGCTGGTTGTTGTTCATTGTTTCTTTTATGGGTAGCGTTTGACATGAACGCTGTTGATAGTCTCAAA
CGTACGATAACCATGCACCCCAGTTAGCGTGCCATTCTTGAGGCGGATCAACGAGAGCGTTGGCTTTGTAGACAAGACGAGCTGAGTGGTTGTTCATAGC
AACGGGGGCAACAACGCGCGATGCCGATTCTGTAGGCTGGACTTGACTACTGGAGTCTTCACTGCCACGACTCACACTGTCTACGTTCTGCGCTTCTCCT
CTCACGCCGTCGTGCTCATGCGCGTCTGCGTCAGAATCACACGGTGCCAGTAGACCTCCGATGTCCATTCTCACGCGCGAAGATGTGATGAAAGCGCCTG
GACACGCGAGCCCACCAACGCTTGAAGCAGAAGACACGTGTAGTTCTCGAAGGAAAACTACGCCGACATCGCCCGCGAAGACCTTGTCGAACCAGTGCCG
AGGTCGCGGTCGTTTCTTCTCAAGTGCACGGCGGTGAACAAACTTAGCTCTATTCCGCACGCGGTTTTTTTTGCGGTAATTTAAATATATTCGGTCCAGG
ATAATCCTGTACGCATATGTTAGTAAAATCCTGGATAATTCTGGATGGTTAGGGCTAAAATAACCCTGGACTCCAACAGTTCCGAAGGAAATTCGGTATC
GCGACGATTTATAGATAAGTCGTGCGAGTTACATAATGTAACTTACATTCCAAAGTGCCAAAAAGTCTGCAAAGCATAATAGAACATGTCATGTTAGTCG
ACGACTGACCGTGTTGCATTGAAAGAATTTGCTGCACAAAAAATGTACTTCCTCCGGTTGGAAATGATCACCGGAAGTCATTATGATAGGCCGGCAGTTT
TTTCTGTGACGGCCGAATCTTATACACGACAAATACTAATTTATAAAGTGTACTTTGAGTTCAAAGAAGGAGAAAGGTATCTACTTCGAAGTACTTTTCA
TTTAAAGAACAGTGCACTACCACGATTTGAAGATTGGAGTAACGCAAGTGCGGCGTCATACAGCTCTCTACTACACGATAGACTTACCGGTAGCTCATTC
GCACGTCGGAGTTTGGCCTACCCCAAGTGTGGAAGCTTGTAGAGATCGCCGCCAGCCTCCTCCAAGATTGCCCGCATGCACGCCTGTAGCGTAAGAAAGA
TGTTGTCCACAGTGTCGGGTTTGAGCTCCCGAAATGCGTCCTCAACCGAGCGCATCGCTGCCCTTCCTTGGTAGACGGTGTTGAATGCTCTGCATTGAAG
CTAAAACAACCAAGTCAAGGCAATTGAGCTCGGGTGAGTTGGCTGCTTGGCATAACAGCCTGATGTTCCACCCTCCTTCTGTGCCCGCTGCGACAACGTC
CGGATCGGTTGGCGACACGTGCGGCTTCGCATTATCTTGTTGCACGAAGATGAACTGGCGACGATCCTTCCTTGGCCACTTCGACTTGATAGCTGGGAAC
ACCTTGGTGATCAGATAGCCCTTGTAGACATTTCGATCGACGGTATCAAGATTGCGTGTGCAAATTTCCCCCTTGGCTCTATTCTTGCTCTTACGCTGTG
CCTTATACTTCTCCGTGAAAGACCAGAGCCCCACCTTGCCATCCCATCTCTGCTTACGGTGTGGATCGTACCTACACAGAAATTTCATACACAGTGTCAA
AGGTTATCCACAGTATAAAATTATAAAAATATAGAGACTTACCGAGGGCGTGCGAGTGCTGCCAGGAACATGGTCTTGGGTATGAAGCGCTTGCTCTTCC
AGGCTCGTGGAGGCATCTCTTCACCGTCAAAAACAAGGTAGGAACGTCTGTTGCGGTCTGCGTAGAACCACTTCTCATCGACGTGAACCACGTTGTGCAT
CGACTCGAAGCGTAACGTCTTGTCGTCGATGAACGACAGCGCATGTTCGACACGGTCCAGCTTGTTCTCGGGGGTCAGCGCCGGCTTGATAAACGTCGTA
CGACGCCGTACCATGCCTTCCTTCACAGCTTGTCGTACTAGGGGCCGGGAGAGCCCTGAAGCAGCCGCAACGCGCCTCTCAACTGCCCTATCCTCCACAG
GAACACTCGCCAGCTTCGTCCGCACTTCATCTCGATTCTAACGCTTCCTACCGCTGTTCCGCTTGATCCGGCTAGCCCACTCGCCACCCGGAACACCAGC
CGCCACCGCAGCCGTGTAGCGCTTCCAAATAGCGCTCACGGTGGTCGGGTCACTCTTCACATTGGCCCCGACGCGGGCGAAGGCTCCGCGGGGTAGAACT
CCATTGTCACTTAGCTTGAGGAGCTCGTCGATGATGCCTCTGCGCTCCATGTCTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATAC
AAACTCCAACTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGACTTGACTTGAAAAGCGGTAGATCTAAGACTGAATGTATTTATAGGTTGGTA
CAGATTTGGCCTGCATACAAATCCTAAGTTCCCTGTAGTTTGTGTCATACAAGATGTATCTGTTGGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGT
GACCGATGTAGCCATCCCGGAATAATGACAGGGTCACTATTCCATGTAACTCCGTTACATCCTCCCCCACTTAGATTCGCTCTTATCGACCAATCAGAGC
GAGGTTACGCCGGCGACTCACATTTCACTCGCAAAGTCGAAATCCATCGACAACGGCGCGAGCTCTGGCGCCTCGGCTCCCGGGCCTCACAGAGCAACTG
GCGCATCGCCGAGCAGGCCGCAGGGTCTCCACGTCGACCGGAAGCATGCCTCCAAAGCGCAGTGCGCGCAGTGCGAAAGCACCTCCGAAACCGCGGGCCG
TAGGACCGAAGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCGCGCTGATGGAGGCCACGAAGGCGGCCAAGAAGGTGGTGCGCTCTCGTAGCAGCAC
GCCGGAGAGTGGCCGTCAGGCTGGGGCTCGGAGAAAGTCTTCTGACGCCGCGCAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAGCCCGGCTCGCGAC
TGAGAAGCCGCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGTGAGAGTTCACCCGACGACTAGAACGTCTCGGAGGGTAGCACGCACGCTGCCGAAG
GCACGGAGCTGGCGGCAGGCGACATGACCAACGCCTCGGCCGACGCAAAGGCCTCGTCAGAGAAGGAGGCGGACGACGCCGAGTCCGGATCAGGCGACAG
CAAGCAGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTGGCCGAGAAGTCGCCGAGCGACGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCC
AAGCATCTGACGCTGGCACAAGGTTGTGAGCGTGCCCAAGCGTCGAAAGCGGCTGCCCCTGCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTT
CCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGAGTCTGAGGACGAGGAGGGTGCCGTCCACGAGCCCAAGGAACTCTCCAACAACCT
CGACGAGCAGCAGCAGTAATACCACGCTGCTAGCTCGGGTGCGTATGCCAGGCAGCCGACTGCCACGACTGCCATCGAGTCTTCTTCAGGCGGGGATGCC
ACGTACCCGCAGGGCTACTTCCAGCCCGAGCCTGGCACTGGTGCGCCAGCGCTGATGGAGAAGCTCTCGGCTCCTCGTGGCCTTATCGGCGGGTACACCT
CGAGGGGTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTTTCTTGGCG