Description :
From Genome Similarity Track
Location :
scaffold_38:20624- 22373
Transcript NameFunction/comments
g12657.t1hypothetical protein

Sequence
1749 bases(100 bases per row)
CGCGCCTACCAACTACTGACAGTTGACAACTTCGATGCCGAGCCTCGTTCAGATGAGGGACGTCGCCGCTTGCGTTTCTTCGCTAATTCGCTCTTCATGG
ATATGCCTGATGCCAAGCACATTCGCAAAATTCGTTCACTGACGGTGTCGACACCGTACTACAATGAAATTGTCTTGTACTCGATCAAGGATTTGACGGC
ACAGAACGATGACAGCATCAAGCTGTTGTACTACCTGAAAACCATCTATCCATTCGAGTGGGAGAATCTGCTCGAGCGACTGCAGGCCAAGGACATGGAA
GAGGCCCTAAAGAAGTTCCCGGAGGAGGTTCAGCTGTGGGCCAGCTACCGTGGTCAGACTTTGGCGCGTACTGTACGCGGTATGATGTACAATGAAGACG
CCATTCGGTTCCTTCACTGGTTGGAGATTTGTGAAAACGAAGTGATGCACCAGTTTGGATGTCCGTGCAACAAGTGTAAGCGATTGGACGAGATGGTTGC
CCTGAAGTTCAACTACATATGCACGTGCCAAATCTACGGTAAGCAGAAGGATGAACAGCGTCAGCAGGCGTCTGATTTGGAATATCTGCTTCGCAAGCAC
CCGACCCTGCGGGTTGCCTACGTCGATGGCCCCAAGAAGATGAAGGAGGGCCCGCCAAAGTTCTTTTCTGTCTTAGTGCGAGCTGACAGTGAAAACATTG
CTGAGGTCTACCGAGTGGAGCTACCAGGCAACCCGATCATTGGTGAAGGTAAGCCTGAAAACCAGAACCACGCTATTATCTTCTCGCGCGGTGAGCTACT
GCAGTGTATCGATATGAATCAAGACGGTTACCTTGAGGAGGCTCTCAAGATGCCGAACCTGCTGTCAACGAAGGACAGCGAGACTGCTAAGTGTCCTCTG
ACGATTATTGGTTTCCGTGAGCACGTGTTCACGGGCGGTGTTTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGC
GTATGCTGGCGATGAACCACGTGCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGGGTTGCGGTGGTACTGCCAAGGCTTCCAA
GGGTGTGAACCTTTCGGAAGATATTTTTGCTGGTTTTAACTCTACTCTCCGTGGCGGCCGTATTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGT
GATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCCGGCGAGTGTGTGATTTCCCGTGATGCGATGCGTATGGCATCTCGTC
TGGATTTCTTCCGTCTGCATTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAA
GGTGTACATGGCTCTGAGTGGCATGGACAGCTTCTTCCTTGAGAAGGGTGGTCTTGGTATCGGCGGCACGCTTAATACGTCATGGGCGTTCCAGTTCGGT
TTCTTGTTGGTGGTGCCTGTTGTCGCCGTTGTTGGTGTGGAGCAGGGTTTCCGTCATGGTTTCACCTATTTGGTGTGGAACATCATGACTCTTGGTCCTC
TGTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCACGAT
CAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCAC