Description :
From Genome Similarity Track
Location :
Scaffold_208:20622- 23412
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.2Dicarboxylate/amino acid:cation
Pytap_DAOMBR444maker-pag1_scaffold_208-snap-gene-0.16Nucleoporin Nup43
Pytap_DAOMBR444maker-pag1_scaffold_208-snap-gene-0.25Appr-1-p processing enzyme family protein

Sequence
2790 bases(100 bases per row)
GCGCCGCCGTGCGCCAAAGGCCGAGTAGACAGCACCGACAGCATCTTCCACCCTACAAGATAGCGAATAAGGCGCTACTGCGTCAGTAGAGAGATACCAG
TAAGCAGAGGAGATAGAGTCGCATGCATGCCGcTTCCCTCAGATCTGATCGAAACAGAACTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TGAGCTGCCTGGAACCTCTCTATCTGCTTACTCGTATCGtCTTCGACGGGTTTGGCGCCATCCATTGCCGTCCAGCTCCCTCGATACTGTACTCCAGTAT
GCAGGCGCCCGCCATGAGCAGCTTCTCGTCGCTGGTTCCTCATGCGCCGCTGCGCAACGGAACTCCCACGGCGACATCGCAGTCGTCCACGCACTATGTC
GGCGAAAGCGCGCGGGCTGTGTGCTTCCTGAAGGACGCGCGCATGTCGGACGAAGACGCGGAAGGCGAGTTCCTGCCGTTGCTGGCCGTGGGTGATGACG
ATGCGCTGGCGCTGTATCTGCCAGTTGTGACGTccctAGACGAACAGGCACTTCGAGAAGAGCTCAGGTGAGTATCAGTGTGAGGTGGGGGCTGAGCGCA
TCTAAACctCTCGCCTTTGAGTAGCTCCATCAAGCCTTCCACTAGGACagaaGGCCGCTGCGAGCTCACCGCCGTGGCTGACATCGCACACGAAGGCGAC
GTAACGGCACTACGCTTCGTCTCGAGTGGTTCTTCTAACGTGCTCTTAaGTGCGTCCACGACCGGCAGCGTGCACGCGTTCCGTGTTGGCGACACTGGTG
ACCAGATTATCGCGCCGGTTGTTGTCCCGCAATGGAAGGAATTGTTCTCACGCAGTGCAACAGCCCTGGATGTCAACAGCGAGAGAGGAGCGGTCGTTGC
AGCATCCGAGAGCGGAGAAGTGGCGTGGCTCCGCTTTGAGGACGGGGGgAAGAGCGGATTCAGCGCGCAGGTGATCAGGAATCCCGAATCGAGTCGTCTC
GCCCTGAACGGCATCAAGATGCTCGCACGCGAGACCGTCGTTGCTACAGTCGGCAGTGCGCCCGGCAGTCAGTTACGCTTGTGGGATATCGCCGCAAACC
AAAACTTCCCAGTCGCTACAGCGTCCGAGTACGTCATCCTCATCGCCTGCGTCTCGATCTAGAGCACTAACACGTCCTGTATGGTTGCAGCCCACATGTT
TCGTCTGCTCTTACTAGTCTGGAGACCCATCCGACGCGTCCAGAGCTCCTCATCACCGGCAGCGACGATGGACGGGTGGCGTTGTGGGATCTGCGCCGCC
TCGACGCTCCGCTACGTGTCGAAGCCAAACACCAGAAAGCAGTCCGAGCACTCGCTCTGCACCAGGCATCGCCTCGCCTGCTTTTCtCTGGAGGCGACGA
TGCCACCGTACTTGCTTGGGACTTTCATCAcGGCCGACCAGCGAGTGAGCCGGTCGAATACGAGAAGCACATGCACTCACAGCACCAcGGAGCTGGGCTG
CATGtCCATCCGATTAATtCGGGTTtCcTCCcATGGCGCTCGATGGACTTTCACGCAGGCAGCGACACGCTGGTCGCAAGCTCGGACGCTCAGACGCTTC
TGCTGTTGCGAAACGCATCGCGTGCCCACCACGTTGGCCTCATGACGCAATAGAACCCACAAACGCCAACTCACATGATTCTTCACACTAAAATATATTG
GCCACTAGTGTCGCAGCCACCTGCTCACATGACAGCCTCTGGCGTGGTCTCTTCAGCTTCATTGTTTTGATCCTGATCGTCCTCACAAGAGTTCCGTGTT
TTTGCTTCAGGGGTATTTGGCTCCTTCCTGGCATCACAAACAATCCATCAGTTGTTATGCCCTTCACAaTCGTATCAACATCAACGTACGGGAAGATGTA
ATGAGGGAGaTCGAGCGAGCTAGCAACATTCTTGAGATCATTTGAAGATGACAAGTATACCATCTTCTTGTAAAACGCACTGGTTACAAAACCTTTGGCC
AAGAGGACTAGCAGCTTGAGCCACATcGTCGGCTCAAAGATGTAGAAGAACTTCAGATTTTGCTGATACTTTGAaGAAAATGTCTTGAAGAGCCGTTTAA
GCCATGCGGCAGCTGGTTGGTTTTCTTCAGTCGAGTCAGAATGGATGTAAAGCACGCTGTAACTCTTCTCGACAACGGCATCCATCGTCTGAATGATGAA
CAACATTACTCGGTCTAGATCcaCtttGGTCATGTGGAGTCGGCTGGCCATGTAGACTATCACGGGTGCGCCGGAATGATCGACACCGGCGTTGTACAGA
AACTCCATCTTCTTTAGGTCTTCAAAGTCTTGTTGATGGGCCTTCTGCAATGCGGCCTGGTaGGTTAATACGtCTTTTCGGAGCTGTTGCGTCTTCATGA
GCtGTTTCTGGCGCTCTTCCTGCAAGCGCCGCAGCCGCTCCAGCCTCTCgaCGTCAGGATCGGCAGACATCTCACAGAAGCTCTGTATGGCTGTATCTTC
GTCATCATCAGTGAGCTCGTCTTGATCGTCATGTTGATTGCCAATCAGATCGCCAATGCGAATCTTGCGCTCCTCGATGATGGGCTcTCC