Description :
From Genome Similarity Track
Location :
Scaffold_108:206173- 211367
Transcript NameFunction/comments
Physo_142128hypothetical protein
Physo_109445hypothetical protein

Sequence
5194 bases(100 bases per row)
TTTAGCAATATGGAAAGGACTGGGCGACACTAACGGAAAACATTCCGACGAAGACGGCTGCCCAAATCAAGAACTATTACCAGAACTACAAGAATCGACT
TAACCTGCAGGATATTCTGAAGCGCCGTATCGAAAACGCAGCGACAAGTGGAACCGCTAAGGGGGCAGCGTCAGCGGCTGCGAGTGGTAACATGACTGCG
TCTCCCCGGTCTGCCGCCGCTGGGCTTATGAGTGGTACACTGCGTCAGATGGGCCGTTCGGTCGAACTTCCAGGTGGAATCTCCATGGGAATGCCGAGTG
GATCATTGGCCGTGGGGGTCAGTGATGGCAACATGTCTTTTCAAGCGGCACTAAATGCAGCACAGCCAGGAATGCATAACGTGGGTGAACTCGCGATGAA
CCAGTTCGGAATGCAAGCTCATCAAGACCCGCAACATCAGCAGCAGCAACAGCAGTCTCGCGAAATGATGAACCCGGCGTCCAACTCGGAGCGTTATCTG
AAGCTGCTGAATATGCAGCATCAATTGCAAATCATGCAATTCCAGCAGCAGCAAAAGTCGCAGGGGATGACTTCTGACAGCACTGCCGGAGGAAACAACA
CTGCTCAGTTCCACGAGAGTCAGATGAGTGCTGCGAATGCGCAGCGACTTTATCAATTCTCTCGTCAGCAGCAGCAGCAGCAGCAGCACCAAGTACCCCC
ACAGCATTTGTCACTGCAAGCTCTCCAACAACTAGGACTTTCTTCCCAGCCCCATGCCTCGTCGCACAGCCAAGTAATGCAGCTTTCGATGCAGCAGCAC
CACCAAGCGAGGGGATCGTACGCTGAAATGGGTCACCCGAGCAACATGTACCAACCCATGGCTCAGATGCAGACTCAAGAGCATCCTCAGCAAGCAATGG
CTACTGCTGGACAAATCGGTTTATCGCCAACAAGCGTTCAGCAGTACGACAGGCCCGTGGATACGAGTACGAGTGTTGGGGCAGATGGAATGGGTCCAGC
AAGAGGTAACGCTGGAGGTACCCCGAATCAAATAGGGCGCCATGATAGCTCGCAGCGGACGATGATGAATATGGCGATGATGAATAACGCGGCTTCTGGA
AATGTGGGCACTATCTCGCAGTCAGCCAGCAGCCCCCATCAACCTTCAGTAGCCCCTCCTCGCTCGATGCCGATGGAATCAAGCAGACCAGCAGAGAGGG
AGTCGCGGCAAAGTGGTTGGCAGCCTTCTCCTGCTGCGGGCGCTCCTACTCCTGGAGGTGCTAAGGCGCAGGGGTCAACAACCAATACGGTTTCGAGCGC
ACCACAGCAGCAGGACAGCGCCCCTAAGGGCCGTGAAGCGCTCGCACCGCCAGCACCTCCTCCTGTGCAGCCTGTCCGCAGCCGGATGTCCTTCTCGTCG
ATTCTGAACGAGTCGGAGTCGCCGAGGGATGACACTCCTAGAGGGAATGGGTCGATGGTAATTCGTCAGCAGGAGTCGCCTCGCGTTTCTGAACAGCAGC
GTCAACAGCGAGAGCAGCAACAACAACAACAGCGGCAACAGCCGCAGCTTCGTATCGAGCACGCTCGTGCGATTCCGCCTTCTTCTGCTGCCGAGTTGGC
TCGATCTCCTGTGTCTGCGCCAAGCCCGACTGCGCACTTGCTGCCGCGAAGGTCTTCCGCGCCTGCTCATAACCGGATGGGCTTGATGTCAAGCCTCCTG
AATGTTCCGTCACCTGAGCGCAGGACCTCAACCCCCGGCCATCAGTCTCCTGTGATGCATCAGCAGCAGCAAATGCAGCGGCAAATGCAGGCTGCTCGCT
ACTACGATCCAAGTGCAAGCAGTGCTGATAGCACGGGTACGACTTCGCGAGGCTCGATTGCAACGATGGTGAGTGGCGTTCCTGTTTCGTCGACGATGTC
ATCCACGATGGTGCGCAGCAGTCCGAACGACAAGATGTCGGCTCCAACGAGTATGGCCAGCTACACCAACGCGTCCGCGCAGATGGCAGTGGCTCTGACA
CGCAGCGGCTCAGGTTCTTCCACGTCGTCGGCGGTTTCGGCAAATGCTGTGAAGGTGGACCCGCACGCTCAACAACTTCAGCAGCAGCAGCAGCAACAAC
AACAGCAACAGCAGCAACAACAGCAGCAGATGTGGAGCTACGCGCCCCAGATGCGCCTTGAAGAAGCCGAACTGCTCCTGCGGGCCCAGCGTGCAGAGGA
AGAAGCTGCCAGAGCGGCAGCGGCGGCCGCTGCCGCTGCACGCGCTCTGCAGGAGGCGCAGAAGGCGCGTCAGCAAGCGCTGGACATGGCTGCCAATATG
GCGCGGTACAACAGTGCAATGCAGCAGCAGCAAGCTCAACAACAGCAGGCCCAGCAACAACAGCAAGCCCAACAGTACCAACAACAGCAAGCCCAACAGT
ACCAACAACTCCAGCAGTATCAGCAGCTTCAAGCTCAGCAGCAGCACGAATACCATCATCAGCACCAAGCCCAACAGCTCCACCAGCAGCAAATGCAGCA
ACAAGCGCTCCACCACCACTTGCAATTAATGCAACAGCAGCAACAACAGCCTCCCCGTGGCCCTGAGCGGTAACAGCGCCGACCATGAAGCTGGTTTGGT
AGAGGATCACGGGATCACGGAGGGCACGCGTCTCCGGGATACCCGTCACACAGCCCGCGCAACGTTATTATCTATGGGGTGAATGTGCTAGTATATGAGT
TTGCATTTTGTATTTTGTTGTTGTTGTTGTTGTTGTTCTTGCTGTGCCTACTCAGCTGTCATTGCCCATGGATGGAGAAGCGGTGAGTCTCACGTATGGT
TTGATCTCGTGGGTTCCTTGAGGGAAAAGCTTCTTGGCGGCGTCGGCAGTGACATCAGGTTGGACGAAAACGTCGTCGCTCACCTTCCAGTTCACGGGAG
TCACCACTTGCTCGAAGGTGCTGAGCTGGAGAGCGTCCAGGGCACGCAGCACCTCATAAAAGTTGCGACCGACTCCCATGGGGTAATACGTCAGCATACG
TACGGTCAAGTCGAGGTCCAGGACGATAGTGCAGCTGAAAGGCAGACGCCCTGCGTCGGCGGCGTGCTTTGGAGCTCCGGCTGCCACAAGTCCCAGTCGT
CGAGACAACTCGCCATCCTCATCGGCCATCACCGGGAAGCCCAGCTTCACTTCCTGCGTCTCGTTGACGTCGGCTAGGAACGGGGTCTGCTCCCTCACCG
AGGATACGTGAAGTGCCAGAACGCGAGCATTGCGTGCCTCGAACTGATCGTGCAGCTTTTGCAGCATGCCAAGTTCCGACAGCCATACTGGGTGCTTGGC
TTGCGGGAAGGAGCAGACGATGCCCCAGCAACCCGATAGATAGTCTTGCGCGCGCACGACTCCGACCTGAGATTCACACACGAGGTCGGGCAGTTTGGAG
CCCACTTGCACCTGCCGCGACGCTGCAGCCATTTCGCCACTTTCGGATCTCTAAGACTGCATCCGACCGTTCAAGATTAGCTGGTATTCGAGAGACGGCA
TGGTGAAGGAAGAAGCTACAGGAGGGCAGTCGGATGCGAGTGGAGACCAGTCGCCGACCAAGAAGAAGCGCTCACGAAGCAAAAGGAAGGAGCTGGGACT
TCGCAGTCGACGGAGGGGCCCTGCTTCACCTGGCAACAACTCGAACGACGAGCAGTTTGGGGATACGCACAAGCCTAAATCTCGACAATCTCGACAGCAA
AGTGAAGCTGAAAAGCGCAACCAGGTTGAGAAGCAGCGGAAAATCCGTCACGACGCGGGTGGTCGAGACGCCCCGACCAACAATCGATTTCTTCGTGCGA
TTTCGGGACAACGAGCAGCTACCGGGAAAGCAGACCCAATCGAAGCAAAAGAGCGTGATGACAAAGGTGATGATGATGACGACGATACTGCAGATACCAC
GACGAGTTTGCTGAAGAAAAGAGAGGCAGCACCAAGTGTGAAGTCCACCGAAGGGATTATTGTGACACCAGCAGCTCTGTACTCCGGTTGGTTCCAGTGT
CAATCCCATTTTCCAGCAGCAAAGAGATGGACACAGCAACTGATCCAGCAAGAAGAAGCTGGACTTTTTGTTGAAGAGGAGAGGAAACAATTCCATCGCC
TGGAGCATAGTACACTGGACCGCCTTGAGGAACGTCTTCATAGAGAGTTATTCACCCCGGCGCAACGAGAAAAAACGTCAAGTTCTACCCTAACCGAGCA
TAAGAGCCTTTCAGCAGCCCGCGTAATACTGAAACAAGAAGGTGGGCTAATGGAAGAGCTTCTCTTACTGGACACTCCGAGTCCTGACGCGCCTGTGGGA
ACTGCTTTACCTGTTGACGATAACACGGTCACCAACAACTTCCTACAAGCAAATGGCAGCTTACGGGATAGTATCATCTCGAACGAACGGGAGCAGACAC
CAAATCTAGCCGTGCTGGAGCTCTTTGTTGACCGTGTTGTACTTGACGACCACCCAACATTTGCACTCGCAGACCGATTGGCAGCTCAGCTGCGAGCTTT
ATACACAGCGTATGCTCGAATGCAGCAACTACAGCCATGGCAACTGTCACTACAGTGTCTCAACGAGTTCGTTTCCATGATTACCGATAAACTAGCGGAG
CCAGAGGCACAAAAAAGCAAATGCGCTAGAACGGAGCTATCCTCGCGCCAAGTGCTACAAGAAGTAAATCAACTACTGACGGATTTGGAGGCTTTAAGTC
TGCTACACCAGCAAATTCTTGGTAAGGGTAATGAGCTACGCGATGCAGGCAGCCGAGCTGGGCCTGGAGCTACTCTTCGAGTGAAGCAACGACAACGCGC
ACAACCAATAGATCTCTCTCATGTCGAGGCAGCTTTGGAGCTTCTTGAAGTGGAGACAGAAAACCAGCAAGACGAAAATCTGGAGAATGGTAACATTCAG
ACAGCTATGAGGAAAATCTCTGAGCGCTTGGCTACGATTACCTCCACGTCCACCCAAACGCTGCGAACTGTCCTGCAATTGGAAAGTATTGCAGGTGACA
ATCGTTTGAATGAGGTATCATTTTGGAGCCCAAGGTTTTACGTGGTGCTTCGAGTGAATGGGAAAATCGCATGCTCGACGAAGATCCGTCCGTGGATTCG
TGGTGATGTCCGATTCTCTGAAAAGTTGTGCTTCACGTTGCCATTTTTCCCCTCTTCGGTTTGTGCTGAAATTTACGAGCGTCGGAGACTTCTT