Description :
From Genome Similarity Track
Location :
Scaffold_13:206147- 211426
Sequence
5279 bases(100 bases per row)
CTGAGTCTTCCTCTGACTTAAGGAGCTGTGTCGCTCCGCTACACTTGGTTGCACTTGTAGTCAAATTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAAGCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTAATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTCGAAAATCCTTGTATCGC
AAGGCCCGGAGGTGCTGGCTGCACGTATTGAGGGCTTCTTGCAGTACGAAGCGTCCCTTCTAGGGAAGGTCCAAGACCAAATGGCGTCAGCTATGCCTAC
ACGCTATGTGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCATTTAGAGTGGAAGTTAAAAACTACTCAAGAAAGGAGGGTGAAAACCTCATCGTCTGG
ATCCGTGAGATTGAGATGGCCATGAGATCAGGCATGATCAAGCTTGACCATCAACAGGTCTCGCTGGGTATCTCAAAGCTCGATGAAAGGGCTAGAGAAC
GGGCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAATCGCTTAAGTCACAATTGGTACAGGTGTTTTCATCATCGAACCAGGATTA
CCGCGTGCATTCACGCGTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGAC
CCTCTGTCTGAGGCAGTCCATGTGACTATATTCATACAGACTTCGGTTCTGGCATTGCCAGAACCGAAGTCTGTCGGGTTCACCCCTCTACATTCGAAGA
GGCTGTGAGAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAACCCTCGTTCTGCTAGAGCAAACTAGCGCAAA
CTTCACGAGTACTCCGGCCGTTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGCTGAGCAGCAACAT
GTTGTACGACGGTGTTATACCTGCGGAAGCACTAAACACTTGCGGTCTGGTTGCCCTTTGCGTAGACAGCGCCAGGATACGAGTCAACACTCTACCCCGA
GCCAGAAGTCTGGCATGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGAGCGTCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAA
GTTGAACAGGGCTTAGCCCTAAAGAGTTCTATACCTACTGGTATGGAGCGTGGATACAAGTCTGGCTTATTGGTCGCTGAGGCGAAAGCTGAAAAGCCTT
GGTTAATTTTAATCGATTCTGGGGCGTCTTACAATTATGCTCGACGTCGTTCCCTTGAGGGAAGCCAGCGTTATGCTGAAGCGCTTACAGCACATGAGGG
TGATTACATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGAACCTAAAGTTCCTTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAA
CGCTGTCTTGTCTTTTTTTGGACTCGAGATATGATCTCATTCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTTATTGGAGGTCGAAGGCCTT
AGGCGCTACGCGCAATGTTTCTAGCGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGAT
GTCACTGTTCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGATATGGCACGTA
CTCCGTTAAGTGTTACCCGTTGTGATAATGAGCCACTGCATGTTGAAAGCATGGCTGGCCTAGGGCCAAGTTATCAGGGATGTGATTCCTTTACTGTGTG
TGTGGTGCCACGTGAAAATGCACCTAGTGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTGTTGTCGAAACGCCATTAAGTTCAGGG
CTAGGCCTGTATGATGTAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTCGATCAAGACATCACCT
CTCGTAAAGAGCGTACTACTACTAGTAGTAACCACGGGGACACTATTGTCCCGACCTGAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGACGCCA
GGTGGAAACTGTTAAGCGCTAGGCGTCCGTGCAGTCACATAGTGACAATAGTGATACACTACGTACACTTGTTAACGGAGTGACTGGCCAGGTTGAGGTC
ATTGTAGCCTGGAACCCCTTCCATCTTTGGATGCTCTTTATGAGCTAGACGAAATGTCTGATGGCGAGTTCAGCCAGGCCTTGAAGGCAGGAGGTTTATT
CGAATTAGTGGTCATTAGACCCGATATTGAGTTGAACTCGTCCTCATTAATGATATAAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAG
TGGATCTTCGATCCTTAAAGATCCTTTGGATCCACTTTAATCTTTGGTCAAGGAATTTCAAGATGTGGTGTGTCATAATCCACCATCGATCTTACCTCCC
GATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACG
GGTTTTTTCGTGCTAAGAACGCGACGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCG
TATTGTGCACGCTTATAATAAGCTTAATGCTACCACTATCCCGGCCCAGACACCAATCCCCAGACAGGATGTTCTTCAGAACAGTATGGTGGGATGTACA
TTGTACAGTGCGCTTGACTTGGTCGATGGTTATCATCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGTGGTATGCTCT
GGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCTGGCTACTTTTAATCGTCTGTTGACGCAACTATTCAGACTTCATCGAGGCAATGAACAAAC
GCACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACGGGCGATCTGATGTGGATGATCGCATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGC
ACGAACAATTTGTATGCAAATGCATCTAAGTGCATCTTGAAGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAACGAGGCCTTCGAGCGGACCC
CGCTAAGATAAAGGCCATAGTCGATTGGCCGATTCCAAAGAACCAAAAAGATCTACGTAAGTGGCTTGGACTTGCCAATTACTTGCATACGTATAGTGCG
AATTATGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAAG
AAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCGATCCTGATCGGCCTTTCAGTGTCTTCTGTGACGCATCTGACTGTTTCATAGGCAGTGCTCTGTTA
CAAACAGATGTTGATGGATGCAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAAACTATCCAGTTCATGATAAAGAACTACTTGCT
ATGAAGTACGCTCTAGTCAAATTCAGAGTACATCAGCTTGGCTCAAAGCCATTTGTGACCTATACAGATCATGCATCATTGCGCACTGCGACGCAGTCCG
CATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGC
TATCGCGCCGACCTGACTATGATCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGTATGAACAATGTGT
AGCTTTGCTACGTGATCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAAT
GGCCTGTTGTGCTATCACACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATA
ACGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGTCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCG
TACATGTGAAACATGTCAACGGGTGAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTTCCTGTACCCACTGGGTGTTGGGATTCTATGAGTATG
GACTTTGTGTTTACCCTACCGAAAGATTCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGG
ACTCTATTTATGCCGAAGGCACAGTGAAGCTGTTTATTGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATGGAGATCCCCGCTT
CACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCAGCACCCGTTTGGAGATGTCCATAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTT
AATCGCGTCATTAATGACATTCTACGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCACCATGCTCCCTGTTGTTGAATTTGCGTTGAACAAAGCTG
TTCATGCCTCTACAGGCTATACTCAGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAATGCTACCACTATGTGGTTCAGGGCTTGGTGGGGG
AGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTCTCGCACCGCGATTAAATATCTGAAGACATGTACGT
GACGCAATGGCTGAAAGCCAAGATCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTATGAACGTTATCAGGTCGGAGACCAAGTATTACTAAA
TGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTTAAGACAAATTGCGGCCACGTTTCATTGGACCATTCACGGTCGTTGCTAAGAAGGGACTTG
CGTATACGCTCAACTTTCCACGCAAATTGTGCACACACCCAGTGTTCTGCGTGGGATTGCTTAAGCCGTATCGGGATCC