Description :
From Genome Similarity Track
Location :
contig_38:20611- 22360
Transcript NameFunction/comments
g8677.t1hypothetical protein

Sequence
1749 bases(100 bases per row)
CGCGCCTACCAACTACTGACAGTTGACAATTTCGATGCCGAGCCTCGTTCAGATGAGGGACGTCGCCGCTTGCGTTTCTTCGCTAATTCGCTCTTCATGG
ATATGCCTGATGCCAAGCACATTCGCAAAATTCGTTCACTGACGGTGTCGACACCGTACTACAATGAAATTGTCTTGTACTCGATCAAGGATTTGACGGC
ACAGAACGATGACAGCATCAAGCTGTTGTACTACCTGAAAACCATCTATCCATTCGAGTGGGAGAATCTGCTCGAGCGACTGCAGGCCAAGGACATGGAA
GAGGCCCTAAAGAAGTTCCCGGAGGAGGTTCAGCTGTGGGCCAGCTACCGTGGTCAGACTTTGGCGCGTACTGTACGCGGTATGATGTACAATGAAGACG
CCATTCGGTTCCTTCACTGGTTGGAGATTTGTGAAAACGAAGTGATGCACCAGTTTGGATGTCCGTGCAACAAGTGTAAGCGATTGGACGAGATGGTTGC
CCTGAAGTTCAACTACATATGCACGTGCCAAATCTACGGTAAGCAGAAGGATGAACAGCGTCAGCAGGCGTCTGATTTGGAATATCTGCTTCGCAAGCAC
CCGACCCTGCGGGTTGCCTACGTCGATGGCCCCAAGAAGATGAAGGAGGGCCCGCCAAAGTTCTTTTCTGTCTTAGTGCGAGCTGACAGTGAAAACATTG
CTGAGGTCTACCGAGTGGAGCTACCAGGCAACCCGATCATTGGTGAAGGTAAGCCTGAAAACCAGAACCACGCTATTATCTTCTCGCGCGGTGAGCTACT
GCAGTGTATCGATATGAATCAAGACGGTTACCTTGAGGAGGCTCTCAAGATGCCGAACCTGCTGTCAACGAAGGACAGCGAGACTGCTAAGTGTCCTCTG
ACGATTATTGGTTTCCGTGAGCACGTGTTCACGGGCGGTGTTTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGC
GTATGCTGGCGATGAACCACGTGCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGGGTTGCGGTGGTACTGCCAAGGCTTCCAA
GGGTGTGAACCTTTCGGAAGATATTTTTGCTGGTTTTAACTCTACTCTCCGTGGCGGCCGTATTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGT
GATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCCGGCGAGTGTGTGATTTCCCGTGATGCGATGCGTATGGCATCTCGTC
TGGATTTCTTCCGTCTGCATTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAA
GGTGTACATGGCTCTGAGTGGCATGGACAGCTTCTTCCTTGAGAAGGGTGGTCTTGGTATCGGCGGCACGCTTAATACGTCATGGGCGTTCCAGTTCGGT
TTCTTGTTGGTGGTGCCTGTTGTCGCCGTTGTTGGTGTGGAGCAGGGTTTCCGACATGGTGTTACGTATTTGATTTGGAACATCATGACTCTTGGTCCTC
TGTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCACGAT
CAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCAC