Description :
From Genome Similarity Track
Location :
scaffold_22:206103- 207632
Transcript NameFunction/comments
Plaha_PHALS_15017hypothetical protein

Sequence
1529 bases(100 bases per row)
ATCCAGTTGTCTAACAGTTTCCGACTTGTTTCAAATTATCTAAGCACTTCATCGTCATTAAGCACAGTACAATTAAGCGTGCTGTTTACATTCCTAATTG
ACTGAGTTGAGCGACCCTTATCACGTCTGAGCTCCTCTCGGGTGCCTGTATTATAGTTATGAATCTAATTTGGTACAGGACCGCAAATTTACATCACCTT
TATTTCTAGTGTCGACTTCATCGTTTACCGTTAATTTTACTAATAAAATTATATGATTCAATGATTTTAGATAACTTACAGGCGCTTCTCAGAAATCAAC
ACTGACTAGCTAAGCTTCGTCTCTCGATACGCAGCTTATATAATAATGTGCCTTCGACAGCGGTCGGCGATGCAGCCACTTCAGATGGCATCTCGTTTCC
CATCGAACGCTCAATTGAAGATTCGCCCAGTTTTCGGATATGTTTGGCGACTCCTTTCATCTATTGAACTCGACAAATATGACTCTTCAAAATGGCTTTT
GTTAACATTTCCAAAATTCGGCCTTGACGCTACTTATTAAGCACGggattttttgcttttcagCGAGATAATCCGCATTTCTCTGATCATAAATACCGAC
TCAAGCATAATGGGTTGGGCTTTGCTGGGTGTTCGCTGTTACTTCAGATAATGCATGAAGCGAGGAAGGTGAATGCTGATTCTGCATTGCCGCTTTCGCA
ACAATCTCTTAACGGGCATCGGTTTCACATGTGTTGTTAATTTTCACGATACTTTCGACACCGCGACTTTACGTTTGATGATCAGCTTCTTTCGTTGTAT
GACAAtccttttttaaatttcaggTGAACTCAAGCGACCGGCTTGCGTGTACGAATATAGTGGATTTCTTCGTTTTCCTTTCACATTTTTTTGTCGGTTT
CCCAAAAGATAGTTTAGCAGAACAGTCACATAAATTTTCCGAATCCCGGATTAATTGTTACAATAGAAACACACACGACGGACTAGGTTTGAATGTCGTT
ACACTGATAGCATGACATGCGAAATGATATATTCTAAGTCTTCTTACAGCCATCCTCGCGGCTATCTTGTTTGCCACATACCGTCTTTTCCAGCTTAAGA
GTGTGCGCGAACAACTTGGGGCAATCAACGAGCAGATTACGCGATAGCAATGATTTTCGATATATCAAAACTGTTTGACACGTTTGTCAGTTTAAAAACG
CTATAGGCTTTCTGCATCAGCATCTGGACACTAGATATCGTGTGCTTCGCGTCACATCACACTCAGATTCTTCAGCCAAGCTACATGTATTGATAGTAAA
CGGAGGATTTGCTATCCCACACGTTAGTACGTCGTCGTTCTTTATTGCTGCTGGGGTGATTCCATTTTAGAAGCAGAAATGTTTGTGGATCAACAATTTT
CCACATGATCGTCGCAATAGAAAGCGGACAAAGCACCCCTTCCTGCCCCTGTACGCTTACGGGTACATGATGTTGATTCGATGATGCCACTTGCAGAGGT
TGGTCAATCGCCCTGCGATGGCATATTAC