Description :
From Genome Similarity Track
Location :
Scaffold_240:20610- 24035
Transcript NameFunction/comments
Phymu_g7366hypothetical protein PHYSODRAFT_497208
Phymu_g7367hypothetical protein PHYSODRAFT_497752

Sequence
3425 bases(100 bases per row)
ACGTCGGAAGCGACTTCTTACTGGAAGATCGTTTTTGACTgcgagcttccagcgcctgcgAATGCACTAGAGGTGACACCCCCTCTATTGATTTTGACAA
ATCTTAGTGAGGTCAAGTAAACAGGACGGATGGCGCGGGGTCGGATCTTTTACAGAAAAGGAGCACAGTCACATTTTAGCAGCACATTCACCGTCCCGAT
CTTCTAGATGATCTTGTGCGAGCTGGTAATTCCGACGCGGTTTCACACATGATAGCGACACCGACGATCTTTGCATTACCACCGGGCAGGTTATACATGT
TGAGAGTAAGGAAGCTCGATAGCACCCCATACATCAACCCCATCAGAAAgacaacgccaagcagcaccaacacgtCGAACTCTTTCGCCACTACCCGAAT
GTTGTCCATGAAAGATACTGGCGCTTCGGATCAGTGTTTTCCGCTTTGCTCTCACCCGATTCCACCTCAGTGTACCCGTCATTGCCGTATCGCACTAGCG
GGATCAAGCGCAGAACCAACCGCTGTGCTGTTCGCCATTCTGCATTGGAATCGGATTATCTGGTAGATCTTCCACATCTAATTAGGTCGGATGGCATGGC
ATGGCATGGCATGGCATGGAATGGAAGGTaagttaaaaaaaaaaaggaaaATGACCACGAGTTCGGCCGCGTGATATCTGTTAAACCGACATCTGCGTGA
ACTCTACGGATAGAGTTTATTTGTATTGGGCTTGCGGCTTTCAGGCACTGAACCGTATCCGTCCATCTTCATCGGCTGCGGGTTGGCACCGTGCGGGGTG
AAGATctcggcttcttccagtggcaTTGTTCCCTCAACTCCACTGGTGCCTTTCAAGTATGCAAAGACACCCAGcccaagaagagaaagcggCACGCCCA
GACCTGTGACCAACCACATCGTCCGTGGCCCAAAACGTTCGTAAAAGTACCCCCCGACAAGAGTTCCCAACGCCCGTGCAAGCCCGTTCTGAACCGCGTT
CAGGACCCCCATAATGGTACTTGCACAGCCACGGGGGGATGCTGAGTAAATGTACTGCGTGCATGCCGCCCATGCCAATCCGAATGTAGCTCCATGCAGG
AACTCGAATGGAAGCGCGCTCCAGGCGTTTGTCATCATCGCGTAATAGGTAATCCGGATCGCGTAGCCCGAAATGGAGATCAGAAGTGCCTTCACCGTGC
CAACCTTCTTGATGATTTTATCAGCGAAGAAAAAAGCGGGCAGCTCCGACGAGGTTTGGCACATGACAGCAATACCAACTATCCGAGGATCGCCGCCTGA
CAAATTGTACAGATTGAGCGTGAGATAGCTGGCAATCACCCCATACATGAGTCCCATCAGAAACACCACACCCAACAGTACCAACACGTCCAGCTCTTTC
GCCACAATTCGAGCGCTCTCCACGAACGAAGTCCTTCTGGTTGCGCTATGACGGTCGCTCTCCTCGCCATTTTCCAGTGCAGAACCACCACTATCGTTGC
TATATTGCACCGGTGGAATTCGTTTTAAGACGAGTAGCGACGAATACCACAGGATCAACTGCATCCAAAATGACCAGTAAATTCCTCCAGTCACCACCAT
TAACCCCGTGGCGTACGCGCCAATCCCCCACCCTACCGCACCAAAGAGCCGTTGTTTGCCGTACTCTCCCCCAACtctctccagcacgtcgagtACCGCG
TGGTCCAGCAGAGATCCCGACGGACATCTCTGGAAACGAGCCATCACCACCATGAACACCGTCCATCCAAACGAccacgagaagaactggatgcCAAAGT
AGAAGAGGGTCCCCGTAATGATGCAAAGGACGTGGATTCGCCGTTGGTCTCGAAGGTAGTCGGCCACTGCTCCCCACACCGGGGGAGCTAcgatggacga
gaagttcggcAGCGTCTGTAGAATTCCGATCTGCACCTTAGAGAAGCCCGCCGTTTGCTGATAATAGACAGTGAGgaagctggagatggaggacgacCCG
GCGTTCGTGAGCGCGTACATGAGCTTGATCTCCCATAGCGAACGGAGGCCGGAAGCTGCCAAGGACATTGTGGCCCGAGTACCTTTTGATTTGCAATGAG
TGACGAGCCAGTGACACCCCATCTCAACTGAAAGGAACGACTGATTATCCTACCAACGAGGACGGATGTCATAGTCTTGTCTAAAGCTAACAGGGTCAAG
GCTGCTAAAGTCGTAACCTGTTTGTTCGTTCCTGCTTTATCCTGTATCGATATTGTCTTAATGTCCTCCAACGTGCTAGATCACAAACAATGGCAAGCGT
CCTTGCACTCCCTACGCCGTTTTCCGGCGAATGTatccactggagctgaacgCTGGCTTGCACACGTACCGGCGCCCGATAGAACGGAACTTCCCCTTTT
TGACGATGAGGTATCCCGTTACAGCAAAGAGTGCGAACGTTGCAATGACGCCATCGCGCACCCGTGTCGCCACCGGCAGCTCCTGGCGCATACTGAGAGA
AACACTCACAACCGCGAGCGTAGCGagtgcagcctccagcatcACGTTCAGGAAactgtgctgttgctggaaaGTAAACGGAGATTCGTCCCGCTTATCC
GGTGTAAAGTTCCCGACCAGCAAGTCGAACGAGTCCTGGCGAATTCCGTCCGAGAAGTTGTTGAGGTAATAGCGGGTGACCGAGTTCACACCGTCCTGCA
GGGCGCCCGCGATTGTTCGCCGTCCAGTGCGAGTGAAATCCGTCTTGAGTGCACCCGTGCCAGCATACATTCTGCTTACGTAGTCAGCATTGTCGGCCCA
AGCATTCTTGAACACGACTTCAAAGCTCGAGTAGGGAGAGTCGAGCACGCTGTTGCCCTTGTCGTTGCCAGCAGTATTAAATGGgtaaagctgcagcgcc
atgaGCACCGTACGCCGCGCGAAGAGACTCATGACGACGTTCGTGCGATCCAAGTTGTCCATGCAGTTGACACGGAAGACGCCGCGCTGGCGTGAAAGCA
ATCGCCCTTCGCCATCACACTCAAACCATCCGTACTGCGTGAACTGTTCGTCCACTTCCGTCATGAGCTTGGACAAGTTGTGCCATGCCATCTTGCGGCA
TTCGTGGTGGAAGTCGAACCATACATAGGCAACGGGCTCTGCAAAGAGCTGCGAGATCGACGTAGGCGCCGATGGCACTGTAATGCTGAGTGGAGGTGGA
GGGTGCTCTCTTGCAGGAAGCGACACTGACGACTGAAGCGAAGGAGTTGCTGGTAACCCAGACCCTTTGTCGCTGTTACTGGCTGTGGATGCGCTGGTtg
gagatccagcagcagagccgcCTCCACTCGAAGGACCAAAGCCGTTGCTTCCATTGGATCCAGGCGCAGACGGTAGCGAGATCGACAGGCTTTTGTGTTG
ACGTGGCGACATGGCGTGAAgcgca