Description :
From Genome Similarity Track
Location :
contig_54:20610- 21645
Transcript NameFunction/comments
g10748.t1hypothetical protein

Sequence
1035 bases(100 bases per row)
ACCCCGGGGCAGTACGCATTACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCA
GGCGTCTTCTAGTGCTGCGGATATTCGCAGCACTTATTCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGT
GGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAAT
ACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTAGGGGT
GGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCC
CGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAA
AAGGGGCTCGCCTTGAGCGAGTCTCAGCCTTGCTCATTGAAGCGTTCCTTCTTCGATTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCA
GCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGT
GACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAAACACTCAGT
GTCTCGGCGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGGCTTGCGTAGCTTTTTTTGCTTGCGCC
GTTCACTTCTCGTTCGGAGCCCGGCTCCGCGAGTT