Description :
From Genome Similarity Track
Location :
Scaffold_199:206066- 213070
Sequence
7004 bases(100 bases per row)
TGGGTTGATGCAAGTTGCCTGTGGTGGATTAGCCGCGACGAGTAGCACCCCGTATGAAATGACGATGGACCTGGTACGAGCGATGTACGAGAAGGCAAGA
TCCACCAAGATTTATCTCGGATCCACCCTTACCTGGATTCACTTAGATGGATATGGGATATACTATATAAGAGTGGATCGAGTGTGGATCCTATGAACGA
ATGATGGTAGGTGTCCTCGGAAGGTGGATCTAGTAGCCACGGCTAACAAGAAGTCAAGATCCAGCGCGAGGTGCCCCGGATCCCATACTTCCAAAGTTCG
GATCCAAGGAGGGAGGATCCCGCATAGAGGGACCTGGATCCAGGGTACAGGGATGATGGAGGCAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCAC
CGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCAGATCCACGACGAGTGTACACTTACAGTGAAGTGGATCCAAGCGACCTGGATCTGGATGAGT
GTACCCATAATAGGGTGACCATGATGATTACGTCATATAGCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAG
CCGAGCCTGGTAAGGGATTTAACAAGTGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACTGTGG
AGGGCAAGTGACCTGTAGTCGTCTCGGGGGTTGGATTTGGCCTCGGGCGATCGCCGTAACAGGAGTGAACATTGGCCCTGGACAAGGACAGCGTCTACTT
CGCCCGCCAAGCATCAGGTCTCACTATGGAGTAATCAAGATCACGAACTAGAGAACAAGTGGGCACGGAATCGTAACGGAGATGCATCAAGTGGAGATCA
ACTACGTATATCGTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATATGCATTACGTGCCCTACCCAGTCCGCGTTCCAAAGATCTCTCTGTACACAATATTGTTGGTGTGTACGTTCCCGGCCTCATC
GATGGCCTCTGGATTCACAGTGATATTGTTCGCCTTCCTTGAAGTCACTCTCGACAACGATACATAAAGCTGCCCATGGGCGAAGACCGGTGATTCCAAG
TATATCCCACGTGGTGGATCGATTGTCCTTGGGCCTTGTTGATAGTCATGGCGAACGCTGGAACCACGAAGAACTGCTTACGCTTGAGTTTGAGCGGGAA
CTCCTTGTCATCGTCCTCACTATAAAAGACGATCCGAGGAATGAACATCTTCTTACCCTTGAACGGACCGGACATTACGCTGGCCTCGATGCTTCTCTCG
CGCAGTGACACAACTCGAAGACGCGTACGGTTGCAAAGTCCTGCGTCGCTATTCAGGTTTCTAATCATGATGATGGGTGGTCCAACCTTCAGAACAATCC
TGTGCGGAAGGATACCGGAGAAGGTAAGAGAGTTCAAGAACTCCTGCTCAAACATATTTGCATCCGCCACCTCTTCGAGGCTGTCCACCGAGAGATGCTC
CTTCGTTTCACTTGATAGCCGTTCCACAACCATGTCGTTGATACGCCAAACACTTGCATTTGTCGGGGCTAGTATGGCTCGCTCAACGAAGTATTCATCG
GGTAAATTCTCCGTATCAACGCCCGGGTACACCGCATCTATGAGTGCGTTGGCGTTGCGGACTCGACGGTCTTCTTCAACTTCGTCCAAGTCTCGTTCGT
GTTCCTCGTCCGCCGGAGGGAGTAACCGGAAACTTGGGGGAGGCTCCATATTCGCGTCTTCTCCATCAGAGGTCATTTGTTGTACCCGTCGTTCTGGAAT
GATACACATGTCCCGTGGAAGGCATATGTCGCCATCACCGATCTCATGGTTGACTGGGTAACGACCTTCTCCAATTTGAAGTAAAAATTCAGAGAATTTC
GCTAGCTCAGCCGCACTGGCCGCGTCTGAGGCGGTGCGGACACGCATGTTCTCGGTCAGCCGCACTTGACGCAAATGATCCCATAGAGGCGAAGACTTGA
AGCAAGCTTGAAACGTCTCCACCCGCGTAGCATTCTTTAGTACAGGTAGGATCTGGCGGTGATCACCGCTGAACACCATTACCTTTCCGCCGAACGGCTC
CAGCTCGTTCTTCATAATATCCCGAAGCGACCTGTCAGTAGCCTCAAAGCAAGCTTGCTTCATTATCGGCGCACCATCCCAAATGATCAAACTCGCGCTA
CGAATCAATTCGGCTATCTGGCTCTGCCATGAAAAGCTGCACGGCGACGTCTCTGTAAGTTTGAGGGAAATCCGGAATGTCAAATGCGCGATATGGCCTC
CAGCTAACAGAGTGACTGCATTCCACTTGATGTAGCCGCGATAGCAACCTTACGTTGCAGCCGAACGTGGGCGAGTATTTCTCAAGTAGAAACGACTTTC
CTGTTGGAGCAGCACATACGGTAAACTGACTATGGTCTTGACACGCCTACAGTGCTTAGCGCGTTTCATATAATAGTTAGCGCATGGTATCTACTGTGTA
CCCTTGCAAGCTGGCCATCCCTATCTGCATACGCGTTACCGTAAAAAGTACACTCGCTCACTTGGCGCACACAAACCCATGCTATCTGTACCACCAACGC
TCACAGTTCATAATGCACTAATGTGCGCTCACGAATGTAAGCTTCAGTATTGAGTGGGCACTATGCGCGACGAATAAGTTGATGTCCAACCACGTCTGCG
GCAGTGATGACCATATCGGTGGCCATCGCAAGGCGATATGTCTGTACGCAGTACCGTATGTTAGCGCCCTGTCCATAATGGTCGAGATAAGAGCTCGGTT
GAGTCGCGGACCTGTCGCGCGCGTATATATTGCTTTGACTACTGCTAACAGCCGCCTGGTCAGCTGGCCTGTATCAGGTTGCCTGCATCACCGCGGGTAT
GACCTGTGCCCAATTAGTGACGCGCTTGATCATATAGACGGATACATCATAAGCGTAGGTATAGTAAGCTAGGACGATGATGCAAAGTACCGAGATTGGA
GCAGTGACCCAATGCATTGGTGTTGGTTATCACGACCACACCATTAACGCCATTGTGGGATATATACGGACATATCAAAAAGCACGACGGGCTGTTAGGT
AGACAGCGAAAGTACTTCATCTAATGGACATGAGCTACTTTCGATTAAAGTCTAAGATATCTACGATCTAATATTTTGTCTACAGCCATGTGGCTTCGTA
TGTTCGTCATATATATCGGAACCAGTAAATGCCAGTCGAAAGGTTCTACGCCACTCTGTCGGTCGGTTTCTACGCAAATACGGCTGTAAGTGCGTCAGCT
ATGCAAGTAGGATCAATGCATGCGAAAGATAGTGGAACGACCCTTCAGTAGTATCATAAAGAACTCAGCGGAGCAATTTCATGTCATAATATTGGTGTTT
GTGGTAACCATCGGCAAAACCTACCTGTCCTAAAAGATACTTCACGCGAGGAGCCGACCCTACCGTGCTCTAATAGACCGTCGCAATCAACGATACGGTG
TCGACTGCCTCACGGCGACGACGTGCAGATGGTAAAATGTTTGAGTAGGCATATTTACTCCAGCTAAACTGGCAGATGTATGCCAATTTCGAAGCATCAT
TAAAACTGACCCGTCTTCTGAACAGCATATATTACATTTGCAACCACGCGCGCCTCCGATTCGTGACATTTTGGGAGCTATGCGCTCAAATGAGATTATC
GACA