Description :
From Genome Similarity Track
Location :
contig_54:20605- 21640
Transcript NameFunction/comments
g11224.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae
g11225.t1hypothetical protein

Sequence
1035 bases(100 bases per row)
CCCCGGGGCAGTACGCATTACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAG
GCGTCTTCTAGTGCTGCGGATATTCGCAGCACTTATTCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTG
GCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATT
CGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGTCCCGCGTGCGTCTCGCAACGGGGGTGGGGGTG
GGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCCC
GGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAA
AGGGGCTCGCCTTGAGCGAGTCTCAGCCTTGCTCATTGAAGCGTTCCTTCTTCGATTTCGCGCTGAGGGCGTCCGCGCCCTCAGCGATGAGCTGATTCAG
CTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTG
ACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAAACACTCAGTG
TCTCGGCGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTTGCTTGCGCCG
TTCACTTCTCGTTCGGAGCCCGGCTCCGCGAGTTT