Description :
From Genome Similarity Track
Location :
scaffold_22:206041- 207608
Transcript NameFunction/comments
Plaha_PHALS_15017hypothetical protein

Sequence
1567 bases(100 bases per row)
AGGTGCCATCGTTTTGATGAATCAAGATGCAGATACCAAGGGCAAGCTGGCTGAAAAACAGGATCCAGTTGTCTAACAGTTTCCGACTTGTTTCAAATTA
TCTAAGCACTTCATCGTCATTAAGCACAGTACAATTAAGCGTGCTGTTTACATTCCTAATTGACTGAGTTGAGCGACCCTTATCACGTCTGAGCTCCTCT
CGGGTGCCTGTATTATAGTTATGAATCTAATTTGGTACAGGACCGCAAATTTACATCACCTTTATTTCTAGTGTCGACTTCATCGTTTACCGTTAATTTT
ACTAATAAAATTATATGATTCAATGATTTTAGATAACTTACAGGCGCTTCTCAGAAATCAACACTGACTAGCTAAGCTTCGTCTCTCGATACGCAGCTTA
TATAATAATGTGCCTTCGACAGCGGTCGGCGATGCAGCCACTTCAGATGGCATCTCGTTTCCCATCGAACGCTCAATTGAAGATTCGCCCAGTTTTCGGA
TATGTTTGGCGACTCCTTTCATCTATTGAACTCGACAAATATGACTCTTCAAAATGGCTTTTGTTAACATTTCCAAAATTCGGCCTTGACGCTACTTATT
AAGCACGggattttttgcttttcagCGAGATAATCCGCATTTCTCTGATCATAAATACCGACTCAAGCATAATGGGTTGGGCTTTGCTGGGTGTTCGCTG
TTACTTCAGATAATGCATGAAGCGAGGAAGGTGAATGCTGATTCTGCATTGCCGCTTTCGCAACAATCTCTTAACGGGCATCGGTTTCACATGTGTTGTT
AATTTTCACGATACTTTCGACACCGCGACTTTACGTTTGATGATCAGCTTCTTTCGTTGTATGACAAtccttttttaaatttcaggTGAACTCAAGCGAC
CGGCTTGCGTGTACGAATATAGTGGATTTCTTCGTTTTCCTTTCACATTTTTTTGTCGGTTTCCCAAAAGATAGTTTAGCAGAACAGTCACATAAATTTT
CCGAATCCCGGATTAATTGTTACAATAGAAACACACACGACGGACTAGGTTTGAATGTCGTTACACTGATAGCATGACATGCGAAATGATATATTCTAAG
TCTTCTTACAGCCATCCTCGCGGCTATCTTGTTTGCCACATACCGTCTTTTCCAGCTTAAGAGTGTGCGCGAACAACTTGGGGCAATCAACGAGCAGATT
ACGCGATAGCAATGATTTTCGATATATCAAAACTGTTTGACACGTTTGTCAGTTTAAAAACGCTATAGGCTTTCTGCATCAGCATCTGGACACTAGATAT
CGTGTGCTTCGCGTCACATCACACTCAGATTCTTCAGCCAAGCTACATGTATTGATAGTAAACGGAGGATTTGCTATCCCACACGTTAGTACGTCGTCGT
TCTTTATTGCTGCTGGGGTGATTCCATTTTAGAAGCAGAAATGTTTGTGGATCAACAATTTTCCACATGATCGTCGCAATAGAAAGCGGACAAAGCACCC
CTTCCTGCCCCTGTACGCTTACGGGTACATGATGTTGATTCGATGATGCCACTTGCAGAGGTTGGTC