Description :
From Genome Similarity Track
Location :
Scaffold_2276:206- 2528
Transcript NameFunction/comments
Phyta_totarag14316hypothetical protein

Sequence
2322 bases(100 bases per row)
cccGGCGCTCGACGTCCTCGCAGAGATCACACGTCTCCTGTTACAGCTACGTCTCCAACCGCTACATCTGCATCACCGGCTGCTGCGACCGTTGCGCCTC
GAGCTCCAGTTGCGAATGCCACGCCTCTATCTTCGTCTGCTACGTCTCGACCCTCGATTgccgcgtcttcttcaactaCGAATGCATCTCCTGCAACGTC
GGCGTCCACGATCGACCTCGATTCAGCTCCCACCATTGACCTCGATCATGTGCATGCTGATCCTGATCTGGCCACAGGGCTGCCACCGGTATTGACAGGT
TTCCGTTTGCTGGCCGccactgcttctgcagcCGCCTAGGAGCCCCCTACTACCGCtaacgctgctgctgccggccCCGCTGATGACACGCCATCGTGTC
CTGAATGCGCTCGCCATGCGTCGGCCCCAACGGTGCACCTCGATCGATCTCCTGCCAATCTCTCTGCTGTCTATGGATCGCTTCAGGGCGTCCTGGTAGT
TTtgcacgagatcgagatcgcTGTGCGACGAGAGCCCGAGTTCCAGCAATTGCAGGAAGAACATGTCAACCTTCAGCGTGCGTATATCTCGTCTCTTCAC
CACGCTGGCAATCTTCACCGACAGATCGCATCcgccacagctgctgcagtctcaTTCGTCTGCTACTGTCACGGTCGGCACAATTCCTTGTTCGGCGCGC
TCCAAACGGAGCATTCTCAACTTGCGGAGTGCAACTTGACCGTagagcagctgaaggaggcggTCGACTCGGCCATCGCCTCCAACAAGGCGCACATCAA
GTCTCAAGCGGCCTCTGCTTCGGCAATCCGTCATCTTCGGCGTCGTGTGGCCGCGCTTGAAACCTTGACCACAAATCTCGAGTCTCAGCTCTCTGCCGTG
ACGACTCAGCCCGATCTTGgttcgcctcctcctcctggtcTCGCGCGTCGTCTATaagctcaagatcaagcgTTGTCCGATGCTCTTCGAGATCATGATA
CCGCGCGGCAGCGCTGcgaagcactgctgcagtcggAGAAGTCATTAGAGGACGCCGTGGCTCAACTTCGTCGCCAGGTGGAGGCTCAAGATCGAAGAGT
CACCCGCCTGAGCGAAGAGCAAGATAACTTCCAGGCTCAGAGCGAGGAGGCCCAGGCTGCTCATGGTGAAACTGTTGCCCGCCTTGCGCAGAGACTGACC
GTTTGGAGAAAATTCGCATTGATTTCCGGTCGCAAGAGGCCCATTTCTCGTCCATGAGATCAACTATCTCTCGATTGGAACAGGAAGTGGTCCGATGGCG
CGGGGCACACGCTAGATCGCCGGAAGTCctcgcttctcgtcgtcaagATCGTGACGACCTACACCGTGgccatgatcttctccatgGTCACTACGTAGAT
GTCCACACGCGATTTTCCGCCGTTGCGTCCGCCATGGGGCACCTAGTGTCGGCACCTTCGCCGACCACCGTCGGCCGGCGCAAACCAGATGGCGAAGCCA
GCTTAGACCATGCATGAAAGATTCGCCGGACTTCGTCAGGGTCGCTtagttcttcttctgcacgTTTGAGATCTTCGTCTCCTGTCCACACTCCAGTGCG
TTCTCAACTGCGTGTCTTGTCATTGACTCGCTCGCAATCTCCGCCTCTGGCACCTTCACGATCGAGATTGTCGCCCCCAGTGCGGACACCTGTTAGCTTG
AGAAAAGTGAAGTGGAGGAGCGTACGGCGCTATTGTGCGGAGTCTACCGGAATGGAAAGTGATCTCAGCTGCGTCGCAGTACAAGAGCGATCTGACAGTC
AACGAAGCGAAATATCACGGTTTGCTCCTATGCTTCGATCTTCTGGCCGACCTGGACAGGGGACGGCTAATTATCTGCGGAGATTCGAATTTTGGACATC
CGACAGATGCGAGGTGAGATCGAGTGCAAAGAACCTGGGTTGAAATTACTACGCCAGCAGGCTATGGAATGCTTGAGATCGTGTCCAAGTCACGAATTCC
TTCATATGAAGCGAGACTGGAACCAAAGCGCAGATCGACTCGCCGGCGCCGCtcgtcagcgtgaaggaggAACGGTAGTGACATCGGAGGAAGAGTTCCA
AGATTTGATGACGCTTAACCGTCTTGACGAGATGCTAGTTCCCCGATCGGACAGATCCGTGACCAAGCCCACGGCCGCGACAAGATCGCGCAAGCGACGC
AGCCTGGAAGTCCTAAAGGAGGAGATTGTTCAACGAATGAGGGAAGAACGAATCTGTCTGGCccaagacgaagagcagTGGATCGTCGAACTCAAGCAGT
ATTTGCATGGGGACGTAAAGGA