Description :
From Genome Similarity Track
Location :
Scaffold_320:206- 1862
Transcript NameFunction/comments
Sapdi_VS20SDRG_17388hypothetical protein

Sequence
1656 bases(100 bases per row)
TTGCTGTGGGTGGATCGAGAGCTGGGGTGCCATCACGCACTGTGGTACTGCGTCGGCTTCGTACAGTGTACCCGCCTCAGTGGCGATGACGCACGTGTCG
CAGGATCCAAGATTGCTTCTGTGGCGTCGGCAGAGATTCTTCGCCCATGCACCTGGATGGGTGTCTTGACCCAGCGAGATTCCTTGGGATCTGCAGCTAT
CCACAGCTCACACAGCATGCCTCACGCAATTTAATATCAAGAGAGAGCCATTCCTCTTGACTGAAGCTGAGAACTTTTGTTGTACGCCACGTTGCTAAGT
TGTTAATTAAGGGTTCCTATCATAGTATCTATCCAAGGCTAAGACGATCGCTTTACAGCTGAATCGCCATGCCAACGTTGTCCGACTGCAGGAGCAAGTC
AAAGTACGAGTCGAGCGCGGCGTCGTCGAGGATCTCGTTCTCGTAGTCGTCGGCTAACAGCAGCGCGAGCGGGTCGAGTTCTACGGCTGTCGAGCTGCTG
CTCACGACGCTGCTCGTTTCGTCCGTGTCGTCCTGCGACGACGACGTTGACTGCACGCGGTGGCGCCAGCAGTAGCCGCCCGTCCGCGCGTGGGTTTCGC
AGCCTTGCATGCGGCAGCGGCGGCCGCCACCGTGGCGAATGCACTTGCCGCCGGTGTGGCGCACGTTGGGGCAGCCCGGCGACGTGCAGAGCTTGCGGTT
GGGCTTGGGGCCGTGGCGGCAGCAGAACGAGCCGACGCGCGCGCTGGACGAGCAGCCGGGCGACGAGCAAGGCTTGCGGCCGCCGTGGCCGACGCAGAGC
ATGCGCGCGTACACCTGGTTGCGGCAGCCCGCAAAGGAGCAGACGTTGCGGTTTTTGTGGAAGAAGCACTTGGTCGAGTGCGGGAGGCTCGCGACATCGC
AGCCCTCAAAGATGCACTGGGACTCGTTGCTTGTCATTTTGGTGGTCGGGGACGGCAAAGAGCAAATTCAAAAGTGAGCCAACCGAGAAAAGTTGGGCAC
CATCTGAGTTTCGATGCATGTACGTAGGCCATAGTAAACGGCGTGACGCAGCCAGTATATGCACACGCCGTGCCATTCATTGGCGCCCACCGGCTGTGAC
TTCGTGATTAGAGAAAACCAGCTGCAACGACATCCGTATTGTAGATCTCGGCAGCACCAATGACTTGGTTTTTGGGTCCCCCGCGCACCAGATGGCGCGG
GGGGCCTATAAGCCGTGGTACGCGGCGCCGAGCGTCAAGGAACTCACCACCAATTCGCACTTGCAAGTGACGGCGTTAACAGCGACCGTCCCGGGCCTGA
AGCGACACCGACGCTCAATGCGTCACGCAGCGCTGCTCGACCTTGCGGCGATGGCCCAAACAAAGCCGCCAACAGAGAGTATTCGTGCTGCAACTAGGAC
GAGACACTTATTTCTAGTGACTTGAAAGTGTTCAAGGGAACACGGGTGGATGGAACATGCAGCCCATGACGTCGTCGATACCCTCGATAGTGCATAACAG
CTAGCACATGCTTGTTGAAGCCGCCGGACATTGGATTTTTCTGACCAGATGACACGTGTAGACAGGCTGGCGTGCCGCAAGGGGATCGTAGTGAGCAACA
CTCTAACGAAATGGTGGTCGTCGTTGCTGGTTCAGAACCTACCTCGCACGCGCAAG