Description :
From Genome Similarity Track
Location :
Scaffold_3368:206- 1597
Sequence
1391 bases(100 bases per row)
GAACCGGAGCTCAACTCGGTGAAAAGCGCGTTTGTTTTGTGGCGGCTTCAAAGACATAGCATGCAGAGAACGCCCCGGCTGTCGTGTGTCTCTTGAAGAA
CGCTTTGAAAGTTTTGTAAGCGTGTTGGAGAGATAGGTGAGGTCGTGCTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGGGTTCAAATCCC
GGTAGGACCTCGTTTTGCACCGCTTCTACCGGCCCTACAACGCCCCAGTTGTTGCTGCGTTGCGCACCTGCCACACGCTACAGCCGCGTCACGTTGTGTT
GCCGTGGTGTGTTATATCGTGTCCCGGCGATCCGCTGCCGATTTAAGTGGTAGCTGCTGCTCTGGCAGAGCTCACCAAGCCTAACTGCCGACTTCGCTGA
CTGCACTACCAATTCTCCAAGACAGCCAGAGGGCTCATCGCAGCCTTCCGCGAGAACAATAGATCCCGTGGGTATCCAAAACACGAAGAAATGCGACGTC
AAAGCGAGTAGCAACCGGATGGTTCGAGGCGGGGATTGAAGCAAGCCTGGTGGCGAAAGAAGCATGCGAGCATGGCCGTAAGTGTAGGAGCACGACGATA
TGTGAAAGGGGTATGTGCAGCACATGTGGCATGTCCATGAATACGTGAATTGCGTGCGATTCGAGCGGGTTGCGGATTGGGCGTGTTGTGTCTGAGCTAG
GTGCTCTTATGGTGTAATATTTAGCTCTCTGGACTTTGAGTCCAGCGATCCGGGTTCAAATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGT
GTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGT
CGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACC
ACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCA
GTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCC
TCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTTGAAGCTGCGATGAGTCGTTT
CCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACGTGGAGCACGAGACGTGGAAATGGAGTCAGTGGAG