Description :
From Genome Similarity Track
Location :
scaffold_2:20598- 22969
Sequence
2371 bases(100 bases per row)
TGATGTTCGTTTAAAATAGCGAGCGGCCTGTCGAGACATGCATGGAGTTAATCAACTCAGATTCTGTGGGAAGGAGAAATCCACACCACTCATTTAATGA
CGTAGTGTAGCTACGCAATACGACATCAGGACTCAACTCATAGATTATATGCAATCATCTATTTGCAGGGTGAACTGCGATTGACATGAACTACTGATGC
CCGATAATCCAAACGTGCACGCGACAACTTTGACGTGAAACGGGTGTTACGGTCAGATATAATTATTATAGGAAGATCATGCAGACGAAAAACGAAGTCT
ACAATACTCTTTATTATTTTCTTTAAAGAAATCTCGTCCGAAATAGGCGCATCGTTCATTTACACAAGGATGACATTGTCACGCGTAAGTTTAAGGATGA
TTTCAAGCTCATAGCTTATTTCGCTGACACTGTCAACGACCGACTGTGGCTGAATGGAACCTCATGGCTTCACTATCTGGCAAATATCCCAAGTCAGCTT
ATATATGTGGGACCAATAAGTAACCCGGGAGAGCTTGAggaacgttttctcacgtctAGGATGGCCACCCGAAGGAGACATGACGATGATGCAAACCTTT
GTAAAATAGAACAATACCCATTGCTGTATCCTTGTGCTCAATCCCATAATACAACAATTCATTGTGTACCCTAAAATGATGAGCTCGCGATCTTATGCTA
GATCGAAGAATACGCGGTACTTTGTCGGAAGAGATCTTGAAGTACCACAATGAGTCCTAAAATGTCCCATCAGATACGTATCCTTCAGCAATCATTTTTG
TGCTCTGTAGTGATAGCTTGTACGCTAATCGTTTGAAATTCTTCGCATTGTCGCCATGACTCGTGCATGTCTTTGATCTTGGACTTTGGATCATAGTCCG
AATGTCTTGACAACGTATCTGCTAGAAAATTCATTTTGCCTGTTTTGTAGTGTACAACAAAGATGTTATTCGCAAAGATGGAGAACCACCGATTCATTCT
CTGCGATAAATAAATAGGTCTTACTGCCGTTGCAGCCAGGTATGATCTGAATAGATCACCAAGTGCTAAATTTCAAGCAAGTACACACGGAACTTGACTA
AAGTATACTTCATCGCTAGAAGCTCTACGTCATGCACTGATTAACTCCGTTCCGCAGGCCGTGATTGTCGCAACTGATACGAAACAACTCGCTCACAACC
GTCATCATCGTTTTGCATCAACGCACAAGCGGTGGCATAAACATTTGCATCGCAGACCGCAAGAAAAGGCTTATCGTGGTTTGCAATTGCAAGGAAAGAA
GCTGCTTCCAAGCTCTGATCCACTTCGGCATATACCGCCTGGTGATTGTTAGACTATTCTCATTCAGCGTTTTCTTCATCAGAGCCGTAAGGGGTTGTAC
CAACGCTGCATATTTGCGCGCGTATATGTGAAAAGAGTAAGTCAAGCCCCGTTATAATCTCACCTTTTTCACATTATAATTTATatctaaaatatcttta
attttaTACGTTTGGCACTCGCCAATCATTGACAGAATTGACTTTCTATATTTTTACACGAGGTCCATTTTGCTGAGAAAGCAACAGAGCATTAGGAGCT
AAGGAGCTAAGGAGCGATGAAATTGCATCTTTTAGGTTACCGTTAGGTTCATTCTCTCGCATGACTAGGAATActtggcaaaaccgcttAATATGAACAT
CGACATCAGACTTCTCACGCGTTGTCTTACTATGCACGAATATATCTTTTAAGTAATCGGGTGCAAACTCTTTCAACTAACGAAAAAGACTTGAGATCAT
TTTGTTGAATGTCGCGGTAGTATTTTCAAACCCTGCGGTATCGCTAACCATTCCTACAGCATACCACTCGTGGAACTGACTGCAATCAGTGGCGTATTAT
TTTTGCGCGTTCATGTCTGATAGCATCAATCTTTCAATCAATCGCACCAGACACACAATTGTCAACCACTGCATCAATATTAATATCACTGCGTGGTAAC
TGAAGTCTAAGCAGGTATGGTCGCATCGCTCAATTTGATAGAAAAATGAACTCTGCGCCAACCATTAGTTGTAATTTCTACACAAAGGTTGGGTTACAGT
GCGGGGgcttgctctcacacacATACCCAGCCTTCTGTTGCTGCGCGAAAAGATCGTCAATTGCAATGACTTGTTTTTTGGCAACGGCCATACAATACCT
CATACCAGGAAGTTTGTCAGTCTGATGGTGAATACTTCTGTCAGATAACAGTACGTCCAGCACCTTGCCTAGGAAAATATCAGCATAATCGTTGACAAAT
TTCTACACGGGACTTTCCCCTACAGCGTTTCATGACTGCTCGTCCGATCTTTTGCCGTGTCTTCTCAATAA