Description :
From Genome Similarity Track
Location :
scaffold_466:20585- 22754
Transcript NameFunction/comments
Pl_104634hypothetical protein PHYSODRAFT_523944

Sequence
2169 bases(100 bases per row)
CTATACGGCTTATGAGGATCGGTGCTGTTTACTCAGCTCCGCATACAGTAGTCGCTTCAAGTAATATATATCCTGTATGTTTCAAGTTTACTGAGCCTAC
CACCAAACTGTTTGAATCGTGGCTAGTACGTGAAGGGACGGTGGAGTGACGATATGTCACGGCTGAGCAAGGAGAAGGTAGAACGATGCAGACAGAGACG
TCAACAATGGTTGGAAAAGCTTTTACCACAAGTGCATGCAGCCAAACGACCGAATTCGGCATATTTGGAAAATGTGGAGGTCATACAGCTACTCCAGCAC
ATTTCGGATGGCGTGAACGAACTTGTCATGGCACGACCTCTATCTCCGCTACCATGGCTTGCAGACTACTTACGACATGCAGTATGTCACTCGTTTTAAA
GTTCTACCTGTTGGTACTAATGATTGAAATTGTCAATGTTTCTCAGTGCAAGTTAGGCTACGAAGTCCAGAACACTGTGTCGGAGAATTTGATCCTCGAG
ATGCACAGGAAACGAAGGGTGATTCAGAGTGCACTCCGTGATACCAAGCAAGACGAGGTAGAAAGCAAACGATTAATCCGAAAAATTATAGCCCTGGAGC
AAGAGTTGAAGATTGTGGGTCGCGAACGCCGTCTGAAAAGAACGGATCATGCATTTCTTGCCTGGGAGCAGCCATCAGTGCAATCGAATTGGAGCCTCGA
TACCAGTAAAGTGCCATTGTTTCCCGAAAAACTTGAAAATCTGAAGTCAGCGGCATCCTCAAGTGGTGAGTCTACTTTCAATCACCTAGCGGAATTGGAG
ACCGAGTCGGAATGGCTTTCAGAACAACTTCGTCTGGAGCTTCGAGCTCAGCGAGATTTAGGCACTTATTTCGACATGGTGATCGATGAAATAGTTCGAG
CACTTGTAAATCTGCTTCTCATCGCGCCAGAAAACCCCGTGCTTTGGTTTGTCATGTATCTTCGTCACCCAGTTGAATTCAAGGTTCCTCAGCAACCTGT
TTCAACCGAATCGCCTCATACGGAGCGCAAATCTTCTGTTGCGTTGATCTCAGTATCACCGCAGTTATTCAAAACAAATTTTGAGTTGACACGAAAACTT
GATGAGATCAAGGAAGCCCAACATGATATGCACATCCGTCTTCAGACAATGCAGCACACTTTCTCGGAGCTGGAGCAGGAGTTAGCTACACGCAACCGAT
TCATTGTCAAACTATCGGAAACCCACGTGACAACGAGAACACAAGCACTCATGGACGGCACACCTGTTTTTCTCAATTCACAAAAGCACTGGGTATTACC
TGGCTACTTGCTAAATCCTAGAACACTTTCTTCATCCGAGTTGCAAGGCTTACGTCGAGCCGAGTGTTTTCTCATGGAAAAAGATGAACTGCGATGGAAG
ATTTTGCTACGCACTCAACTAGAATACGACTCGGCAACGTTAATTCAGAGAATTTGGCGTGGTCGACGAGCATACCGCATTTTCCAGGATCTCCTAAGAC
TACGTCGACGAGCTGCTACTGTGATTCAACGCAACTACTTTCTCTATCTTTTTACTCGCGCTATCAGTTTACCCCGTTGGTGTCGTCCTGGACGAGAGGT
GATAGTAGCGCCAAGCATTGCCCAGAAGTGCGCTGTCTCATTTCAGTTCTACCCCAAGAAGGACTTCCCTGCTGGTAATTATCGCCGTGAACCGAAAGGA
ACCAGCATCAATGAGCTCAAGGAGATAGCTCGACAAGATGAAATGTGTGCAGCCTTCTCAACTGACGGAGCATTCAAACGATTCCTGCCACGAATGCTTT
CTCAGCTCAAACCGATGGTGCTTTCAACGAGTAACAAGGAAAGTGAATCAGACGACGATAACGACCAAAATGGCAAACTCACCGACGAGGATGGCCTCTA
TGTGAAAGTATTGCCGAAGAAAGATGAGAAGCCGATCAACTCGGCCATTATCGTAGAAGTACCTGAGGATCGGTTCGGGTTGATTCGAGTTGTTCTTGAC
GGCATCGCAATCACGGAGCTGGTTCCCGTCACGAAACTCACCGACCGATGGAAGCGTATTCGTGTCAAGCGTGTGAAGTCCAAAGAAAGGAGGAAGACCC
GGGCTATTGTGTTTGGAAAGGGAACCCCTCGAATACTTACTGACGGCACTGAGAATGAGTCGCCCATAG