Description :
From Genome Similarity Track
Location :
contig_27:205787- 207000
Transcript NameFunction/comments
g6966.t1hypothetical protein

Sequence
1213 bases(100 bases per row)
CCGTTGCCCAAGTTGAGACTCAGTGTGCAGTGCTGCAAGTTCGCCCACTGTCTCAATGCTCTGATAAGTGCCACCAACGTCTCCTTTGAAATGTGCAAGG
CCCCTATGACCTTAGCGGTAGATCATCTCGGATCTGCATGCAACAAGATCGGAGACTACATGAAGCTTGTCAGTAGGATCGAGAAAAGAGAGGTCAAGAA
AATAACGATGTACGAAGCCAATCCCCGAGAAGTAAACTCGGACCAAGTACAACAGACATCCCATAGATGGCAGGCGTGGAAAATTTTCAGAGAAACAAAT
CAAACAAGCGATGAAAGAGACATTGACCCGGCTCATCTGAAGTCAACGAAGCAAAACAGACGAAAGCCGAGGAACTTTGAAAGACAGAGTGCACTCGCTC
CGTAAACGGGGCTCGTACAAACAACACGATCGACCAGGCCACCTACTGAGGCTCTACAAGCTGGATGTACTGATACATATTATGCATAACCTTTATTTCA
GCCTATCAACATGCTGAATACCCATATCAACCAATCAAAAGTCGTCATTCAGTACTACATTTCTCATTCTCACATTGGTCGTGGCAACGATGGATGTGAT
CCTGTCGCGCTTCACCGCGGCGGAACTGCGTGTGACGTGCCTGGCCGCCGTGGAAGACGAGCTTCAGCATGCCGAGACGCAACTGCAGCCGGCTCTGGAC
GCGCTGCGGCGGTCCCAGAGCGTCGTGCGCGCTTCCAGGGAGATGGTGAGGGCCCCTTTGGTGCTCGTGGACGAGTCTCCGCAGGTGGCGACGGCGCTGG
AGCAGCTCGTGGCGGCGTGCAACGAAATGGGCACTTTAATTTGTGATTTGAGTCGAGAATTGAGCAGTGTCGGGACGTCAGACGCGTCTCCGTCCGCCAC
GGACGACGAGGATCAACAAGTAACAAATAATTTGTCCTCATTAAATAAGGACAAGGCGGAGCCCAAACGCAGCTCGGGGACAGAGAAAGTGGAGAGGAAA
AAAGCTGCAAAAGAGACTGGGAGGGCTGTGGCTGCAGTGCAGAACACTAGTGCCAGAAGTAAAGCAGCAGTGAAAGCTACAGCTACTGTCATTGACCTGT
CATTGTCTGATGAAGAGGAGGTGGTTAAAGAGGAGGGTGGGAAGAAGCCACAGAGTGCAAGTAACATGTCGGTGAAGAACGAGACGCTGGATAAATCTAG
GAAGGAAGCTGCT