Description :
From Genome Similarity Track
Location :
Scaffold_86:20577- 21638
Sequence
1061 bases(100 bases per row)
GTTTGCTAGTCGAGTTTCAGGCCGGGAATTTTCTCCCGGACCTGTTTATAGAACGTCGTTGCACGAAGGCGCTGTTTGAATATTTGTCTCCCAGAATCAC
AGCGTGTCTCCCTTCCCGAAAAGTTTTGGGAAACCGTATTTTGAAAGGTCATGCAGGGTTTTGCCATGGTATCGAGACAAaaaagctgaagaagaaacaa
gtTTCGAGTGGAGGCATGGTTAATTTCCTGTCTGACGTTTGGCAAAACATTTCTCGCGAGCATTTATTGGGCTGTCAGTTTGCACTATTCGGACACACGC
TAACATACGCGCTGCCAAAGGCAGGTTCGCGTCACGATGGGGTTGTCATGGCGGAAGAGATGGAAGCAATTTTAATTTGGGCACAGACTGATGGGTGGCA
CGTAGGAGCGATTGTCACTGACAATGCTGGTCTTGCGGGAGGGCACGCCGGATCTTGGCGCTCCGTTTTCCCAAAAACAATTTTTGTTCTGTTTCGCACA
TTGTATCAACAACATCGTGAAGGCTGTCTTAAAATCTGCCTTTTCCAAGGTTGCGAAGGGGGCTACGGCAGCCGTCAATGCCTGAATGCCTCGTCAGCAA
AGTGGTTTATACGCGCGAGAGCGCTGATGACAGAGTGCTATGGAAAGCCTCTTGTTCTGTTCACGCTCTGTGAGACAAGGTGGAACAGTATGCAAAACTG
TTTTGCATCGCTAATTAGAGTTCGCACATCACTCGAGATGCTGGCCAGTAAGTATCGCGCTAGTAGATATTTTCCGGGCACATTAAAATATTCAACTATC
GATCATTTTGGAGGGGGCTTTTGGGAGCTGAACGTGTAATTGCACTGCTATCAGAAGCCTCGTATCGACTTCAGCGTGACGAGAACACTTTGTCCGATGT
AGTGATATCTTTTCGGGATAATTATATCGGCTTCGAGGGGTTCTACGGCGACGAAAGTTGTCGAATGGGCTTGATGAAATGTGGTGGGAACAATGTGAAC
AACCTCTCTTCATGCTAACTTTCGTCTTGAATCCGTTGACcgcggaagaagcgcgggAGCT