Description :
From Genome Similarity Track
Location :
Scaffold_23:205740- 208476
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06655Yip1 domain containing protein
Sappa_CBS223.65SPRG_06656WSC domain-containing protein
Sappa_CBS223.65SPRG_06657PREDICTED: aprataxin-like

Sequence
2736 bases(100 bases per row)
GATGGAAACCTCTTGCGAAGAAGACTTGGCTCATGCGCCTGCGGTAGATGTCACGGTCGGCGAAGACGACCTCGAGGATGGTACCATGTCCCCGAAAGGT
AGACGACGACCATGGCCTCCAAGGCTCAGGATGCGTGCTCTTAGCCCAGGACACGCTGCTTCATGGCAACGGCAAGGATGGCCGCCCGGCACTGGGCCTC
TGCGGCTGCTTCACCCTTGGCTTTTACCAACCCGTACGCTGCCTCGTATGCACCTTTCGCACTCAATATGGTGCTATGTAGTACTTTAACGTCGACACGG
TCGACATTCAAGTGCGCTTGACGCGCGCGCTGATCCCGTTCAAGAAGGACCCGTCCTTCAAGGACCTCGCGCTCGCCAACCCGGACGCGTACGGCCCGTT
TTGGCTCTCGGCGACGTTGATCTTTTGCCTGGCGAGCTGCTCCAACATTGCGTCGTGGCTCGATTACGAAGGCGACGACCCGAGCAAGTGGTCGTACGAC
TTTAGCTACGTGGCGACGTCGATGACGATGGTCGGTATCTACCTCCTCGGCCTTCCGCTGGCGCTCTGGTCGGTCGGCAAGTACATCTCGGTGCCCCTCC
CGCTCTCGTTCCTTGTCTGCCTCTACGGCTACTCGCTCAGCATCTTCATCCCGACCATGGTCCTTGCTCGTGCTCGAGGCGTCGTTTTGTCTTACTTGAT
TGTGTGTTTAGTTTGTGTGCACGGCGCCCTCGGACGCGGCCGACTGGGTCATGATGCTCTTCGCGATGGCGTGGTCGCTGCTCTTCCTCCTCACCAACAT
GTGGGGCTACATTGCCGAGTACTTGCCGAAAGAAAAGCTCCTCCCACTGCTCTCCTTTATCGGGTACGACTCGATCCTCCTCCCATTGCATGCGGCTGCA
CGGTGTTCCTAGGACGACGCATTTGGTGTGGGTCGTCTTGCTCAAGCTTCTCTTCTTTTAAATACATTTCGCCTCGGCTCACGTCGCAACTACGGCGGCG
GCTGCAGGTGCTTCGCCATCGACGCGCAGCTCTAACCGACCATACTGGGTGGTCTCTTCCGCGGCCATGACGTCGGAGAGAATGTCGTCTTCGAGGGTCG
TCTCGGCGAGCATGCTTTGGTGTTCTACGCCATCGGTGTGCACATGTACTAGGAGAGGCGCGCTACCTTCTTCGTCGAGGTCGTCAAAGTCAATGCCGGT
TGGCGCGTGCTTGGGCAAGAGCTCCTTGCGATTCCTAACGCATGCGGCGTGAGCACGAATGGCCAATGGAGGATCGAAGACTTTAGAAAGACGGCCAGGC
GGGCGTATTGGACCGTGTTGCGGAGGAGCACGACAAAGTCGGCGGCGACTTCTTCGAGCTCTTCGACGACCGACTCTTGCCGAAAGTAGAGCGCAATCGA
GACCAGGCTCAGCACTAATTGCCATCAGCTAACGTGCCATGGCAGACGGCGACCTACCGGTGGCGACGACGTCAAACAGGTTGGTCCACTTAAGCCAGTA
CTTCTACACAGGCCCATACGCATGAGCCATCATGGCCATAGCGATCGTCGATGGCGTACGCGCTTGAGGGCGAGCATGCGGATGAGCACCTCGAGCGTGA
GCATGCAGCAGAGTGTGATCTCGAGCGAGATGAAGAGGCTCGAGGCCGGCGAGTGCCAGTGGTTGGCGATGGTCCAGCCCACGCAGGCCACGCTGGTTGC
GATCATGGCCAAGTACACGACGCGGTAGAAGGTCGAGAAGTACAGGCGGCTCGCGACCACATTGGCATACTCGGAGCAGGACACGCGATGCGCCATGTAT
CGCCGGTCCTGGAATAGAAGGAGGGAATTCGGATTTGCGGCAGATATTTTAATTAATTGAAATCAGTTTGCGGGACGGGCCACTACGTTACTCACGCGAT
CTGAACTCGGCGGTCATTTTCTGATCAAATAAAATACATTCAAGGACATGCCCTAATTAGGATGTGGCAGACAAAAGTAGGACGACATGGGAACCGTGCG
GCCAGCTCTGGCGCTTGGCCTGACGCGGCCATAGAGCACGACGCCGCCATGGAGGGTACTATTAGTCGACTGAAGCTAGGAGCCTGGGGAGAGCCAGCGT
CAACATGACGTCGGCGCGTGACGTCATCCGAGAGCCAATCAGAAATCGAGCGGCTGCCGGCAAGATGGCGCAGCCGTGGAAGGATGCGCTCTTGGTGTAC
GTGGCGGCGCCGGCGGAGCATGCCGACGTCGTCTTCTACGACGAGACGGTTGTCGTCGTCAAGGACAAGTATCCCAAGGTACGCTCGCTTCGGCGCGAGG
TGGCTAAGCCTGGCTGCAACAGGCCCAGCTGCACCTGCTGGTGCTGCCCCGGCAGCCCATGGCGTTTGGCGTGGAGGGCTTGACGCGAGCGCACATGGGC
CTCTTGCAACACATGGAACGACTCCTGCCTACCATCAGCCATGGCACCGATGTGCGCGTGGGCTTCCACGGCGTCCCTTCCATGCGGCAACTGCATCTGC
ACGTGATTTCGACCGACTTGATCTCGCCGTCGCTCAAAAGGAAGGAGCACTGGAACTCATTTACGACGTCCTTCTTCAAGCCCTTGGCGGATGTGCTCGT
GGCGCTAGAGGCGCATGGCTGCGTACCCATCGATGTCACTGCCGAGCACGCCAAGCTCAAGACGCCGCTGGCGTGCCACAAGTGCAGCTCTACCTTTCGC
CAGCTCCCGCAGCTCAAAAAGCACCTCGAAACAACG