Description :
From Genome Similarity Track
Location :
Scaffold_890:2057- 6624
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_890-snap-gene-0.2Protein kinase
Pytve_DAOMBR484maker-pve_contig_890-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
4567 bases(100 bases per row)
GACCACCTGGACGCCAGTGTCTGGCACCCACTCGGCAAGACCCGGAGCCGCCTCGGCCGCCAATTTCACGCTACGGCACAGCACGCCGGGGGTTCTGTTG
CGTATGATAACAAAGAGCACAAGAGTTAGCTTGCTGTTGGGTCACCAAATGATGCTTTGCAGGCAAACAGTACCGTGCAAATGCGAACTGGAACTGGTCG
CGGTCCGGAGTCACGACCACGACGCGAAGCTGGCTCCAGGCCCAGAAGAAGGAGCGCAGCGGCCACGCAAAGTTCTGTCAAGCGTCAACCCATCAGCGTC
AGCACCTCGCCGCTGCCCGGCCACAGACCGACGCACGTGTCTACCTCGAGGTACGCGAGAGCGGCGTTGGTGGCGTTGAACACGGCCTTCGCCTCGGGCA
GGTGGCTGAATGCGCGGATCGCCTGCGGCTGCATCGTGCTGAATTCACACCAGCACCCCAGCCATTGACAGCGCTGAGTTTAGCACCTTGTTCCTTGTCA
CAGACGCAACATCACCGAGCCGAACGAACCTGTTGAGTGGATCCAGACGCACGCGCAGCGTAGCGTTCTCCATGAAGCAGAACGTGCGCTCCTGCTGCCA
CTCGCGGATCTCCGCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCGTCCAGCCATCGCACTCCGCGGCCTGCACGCAGCATCACCACGTCCA
GTCAGCCACGGTTGGATCCAAGCTCGTCCAGGACTCGGGTAAGGCGGTCTGCACCTCGAGCGGCGCGCTGAGTAGTTCTATCAGCAGATTTGGGAGACTG
AGCACTGCACGTCACCAGCAGCAGAGCTGCCACGAGCAGCGCGAGCCGCGGGCTGCAGGACGCCATCGTCAACGAGCTTGAGGTGGTGGTGGGGTGGCGT
CGCCGACTTTGATGCTCGTTTTTGATTTTTGAGTTTTCAAGTGCATGGGGGCCTCTATTCGAAGCGTAACCAGGTTACATGTGGAGTCCTGTATTCGGAT
GGGGAAGATAAATAATGGCAAATGGCCGTAAAATGCGGTCGCCTAGAAGAAGCCCATGCGCAGACGCAGGATGGTGTCGGCGTCCAGCGACGCCGCATCG
TCCACATTGTCCGCATCGTCCGCGTCGCTGGTCGTCGACACGTCCGAGGAGGCCTCGAACGCCACGTTGCTGAAGCCGNNNNNNNNNNNNNNNNCGTTGC
TGCCGCCGGTCATCGACGCGGAGTCTTCGACGGCGCCTGCCACTTGACCGGCGACCGTCTCATCTGGAGCCGCACTGCCGGCAAAGTCGACCGCTTCCGC
CGCGCCGACCAGCGCACGGGCGTCGACCGCGCCGAGAAGCGTCGCCGCAGCAGCCAGCAATAGCGCTCGCACTGTCTTGGACATTGAGCTGAGGTCGGGA
TGTTCGCGCTTGCAAGTGTCCTGCTTGTCGCCGCCGAGAGAATGCGCTGGACGCGCAGCCAGTGTCGTCGGAGCGCAGGAAGATCACGAAGAGGCCGGGA
AGACAGCGCTGGAGTGACGGCGCGGGCTCAACACCCTCTACGCATGGGTGCTGGGCCGAGCGGTCCGCCAGCTGGCTCCAGGTGAGTCCCACCCCTTAAC
ACCTCGACTCTACTCATCCCGAATGTGGCGCGCGTGCAACGCGGGACTGGCGATGCAAGGGATGGCAGTCCGCCGCCTGAACCGAATGGAAAATGGCTCC
GTCTGCGGCTGGTGGTCGGTCTGATACAGTACAGTGCCCGACAGCACTCGGCCGCCCACCTCATGCCGATAGGAAGGACAAACAGGCTGTCCCCATTGCA
AATGCTGCGAGGCAAACACCAACGCCTCAAGGTGCCGGTCTTGCTCAATTGCTCTCCAAGAGAGAACACTTCGTGCACAATGCCGACCGATAAAGCAATT
TCATGGCTTACATTGGTGGTTCGGCATTCACAACTTTCCCTGGTTGCAAGCTTGAAGTCTACTGCTTAGCCTCGTTGAACACGCCGCGCGCGACGCCCTG
CTCCTCCTGCTGCTGCGCCGCGAACGAGTTGAAGATCTGCTCGAGCGTCGTCTGCGAGACGCTGTACTCGCGCACGTGCAGCTTGGCCTTGACGTCTTCG
ACCAGCGCGAACACGGTCGAGAGCTTGAGCTCGTCGCTCGAGCCGCGCAGCTTGAAGCGGCAGAAGTCGTTCTGGCGCTCCAGCACCACCACGCTGCCCG
AACTGAAGGCGGTGGTGAGGTGGTCGTGGAGCGCGTCGAAGCGAGACTCTTCGATGCACCAGGACGCAAACGCCGGTGCGCGGATGAAGCCGTCGCGCTG
AAGCACTGCGGCCAGGCTGTAGCCCGTTGGATGGGACGGAACGATGCGCTGAGCGAGCTTCGCGTCGCCGAACGCTCTGCATTTCTCCTCGAGCTCTGCG
GCCGTCACCGAGTCGGTGGAGTCGCCGAGCACTTGCGAGAGCGAGTCCTCGATCTCCTGAGACGTCGGCGCGTTCAGCTTAACGTCGAACACGAGGCCGT
CGCCGAAGCGCGACTTGAGGTGCTGGATGCTGCCCAGACACCGCAGTCGGCCGCCGACCATGATGCCGACGCGCGAGCACAGCGCCTCCGACTCCTCCAT
GCTGTGCGTCGTCAGCACGATCGTGGACGACTTGGCGCGCGTCGAAATGTCCGCAATCACGTCCCACATGAACCGTCGGGACACAGGGTCCATTCCCGTG
GACGGCTCGTCGAGGAAGATGATGCGAGGGTTGCCGATCATGGCGATCGCCACCGACAGCTTGCGCTTGTTGCCGCCGCTAAGACTCCCAGCCAGCTTGT
TCTCAAAGTCGCCGAGGTTCAGCTGCTGGATCTTGTCCGCCACGACGCTGTTGAGCTCGCTGAACGGTACGCCCTTGATGGTGGCGAACAGTTCCAAGTG
CTCTCGGACCGTCATGAGCTCGAAGAGCGCGTCGAACTGCGGGCAGTAGCCGATCTGGCGGCGAACCTGCATTTGCTGCGTCAGAATGTCAAAACCGCCC
AGCGTCGCCGACCCGCGCGTCGGCAACACGTCGCCTGTCAACATCTTCATGGTCGTCGTCTTGCCCGCGCCATTGATACCGAGGAAGCCAAAGCACTCGC
CTTGCTGCAGCCCGAACGAGATGTCGCGCACCGCAACCTTGCCGCCTTTGTACACCTTGCGCAGCCCCATCAACTTGACAACGTCGCTTTCAGCGTCGGC
GCTCTCGACGCGCTTGGTCTCTCGCTGCACATCCTCGTCTTCGTCAAAGGGTTCGTCTGCCACATCCCTCGCGCTCGTAAGCCAGTGCTTGATCTTGGGG
AATGTCATCGCGTAGTCGATGCACACCGCGAGGCAACCATAGAACACAGCTGTGACGACCAGGTACATGATCTCGAAGCCCATGATGTCGGTGCCGAACG
GATTCGTCTTGTTAGCGCCACCAGAGTACACGCCGCTGAGTTCGTTCAGCACCAGGTTCATCAGCCCATAGCCCAGGTTGAACAACGGTGAGAGTCGCCA
GAAGAAGACGAGCACCGCGTTCGCGTCCTGCGTCTCTTCGATCACGTCGAGCATGAACGACGCGACCATGAGCACGACGCCGATGATGAAGTTGATGATG
ATCGTGTAGCTCTGCGATGACGCGTGCTCCTTGAACATGTACGAAAGGCAGTAGTTGAACGGGCAGATGGCAGCTCCGAACAGCAAAAAGAGCACGATCA
CTGCTGGGAACGTCGCCGACGTGCACGTGACACAGTCGTCGCCGCCTGTCATGGACGAAATGCCAAACAGCTTGATGAGGATAATGCCGCAGACGCACGG
GATCAGGTAGACGAGGTAGTCAAACACAAAATTGGAGAGCCAGAACGCCCCCAAGGACACGCCTGAGACGAGCTGCTGGTGCTTCGAGTTGTGCTCCGAG
TGCTTCTCCTTGACGAGGAAAACCACAATCGACGCCGGGAAGAACGTGAATGCGATGCAGATGAATAGACAGGCCGTGAACGCCAGGATTGACCCGAACA
GCGCCTTGGTGGACGCGGTCAGCGGGAGCGGGTGATTGTTGACCTTCAAATCGATAGTCGCCTCGGAACTGGCTGCTGTGTCGACCGAAAAGAATCGGTA
GAGCGCCTGGTCGATCAGAGCTTTGAAGATCAGCGACGCGTGCGTGCCCGTAGTGTTCACAAACATGTTGTAGCCGAACAGGTTCTGGTCACTGTCGCCG
TAGACCAAGTACGCGCCGTACTGCCATTTCACTGGCGCGCTCTCAACGCCATAGCCACGGTTGTACACCTCTTGCCCAAGCCGCAGCCCGTAACCAGTCG
CGTCCGACGCGTTGATGGTTGGATCCGTGTAAGTCACCCCGAACACAGTTGGCGAACTGGAGTTGTACGCCGGTCTCGAAAGCGCCACTTCCTGAGCGTC
GGCACCTGAGAAGTGCGAAGCCATAACGCTAGAGCACCACGGTGTGTTCCCGACATCGGCCTGACAGAAGTACGGAGTCGGACTTGCATCGCCCATTGAG
AACGCGTCGGTCGTCAGCGGTAGAATTGGATCGTCGTTTGTCAGACTGGAGCTCTTCAACAGACCCA