Description :
From Genome Similarity Track
Location :
Scaffold_939:2057- 4640
Sequence
2583 bases(100 bases per row)
AAACCCCGACGAAGTTCATCCAAGATCACTCCTGCGACGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAG
ATATGGCGTTGAACACACTGGATGGAATCAATATGATTATACAGCTGCTGAAAGAAGCGGGATTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATAGGATATCACATTTAATCGTCATAGTATGCCTCAGCCGAGTCTGAAATAGAGTTAGGGGAC
TCAATCGGCATTCCGCGGATGTCTTTAGGTCCAGGTGGAGCTGCTCATCTGTGCGATCGCATGGAAAAGAAAGCTGATCTACGTGATCGCGGGGAAGGGA
TTGAGAGCGGACCGCGATCAANNNNNNNNNNNNNNNNNNNNAGAAGATGCGGGTTTTTCGACTACCCAAGCACAACTACAATCATATTTCGTGCTGCCAT
GGAACGAATTCAGCAGGAACACCGTAATCAGGCCCNNNNNNNNNNNNNNNNNNCCAAGAAGTTTACCCAAGTCAGAGGATCGAGGTTGCAAGGAATATCG
AGTCTTACACCCCTGATATCGAGATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAACTTAGGGCAATTCGAGCCAAGACGACCACTTGTGGCTATTGCGGAGACAGTGCCAGATAGTGGACTTAGCGCCCNNNNNNNNNNTTCGGATGT
CTGCAATCGCAGGATTGAAAGCGTTCAAGGGGAAGGAAAAAGACGAAGATCGAGCCAGGAGCTAGATCGGCAAGGTAAAGTCTGCTCTCTTGCGTAATCA
AGCCCCAGATGCGGAGAAGTGCTTTTTATTTGGAAATCTGCTTCCGGGTCCGGCGNNNNNNNNNNNNNNNNNNNNAGTCGATCCGCTCAACATTCGTGGA
AGGACCTATTGGAACGTTTTCTCGCGCAATACGGTGGTAATGGTATGTCCGTTGGAAGACAATAGTATCTCGACAAGAAACGACCAGAGGAGACGCTTCT
GGATTACCTGTATCATTTGTATTGGCAGAGAATCGAGCAAAGATACAAAATTGAGATGGACCCCCAGACATTCGTCGTGAGCATGTGGAACACTTTATTG
TGACCCCGGACGATCGTTATCTGGACAAGCAACTGAAGCTGTTACAGATCGGGGATGTGGATGATATGGAGAGACCTTACGCGCTTACCAGCGCATGGGT
GATCGACAAACTCAATCACTTATGGTACCGAATAAATTTCGCCCACTATCCACACCCACAGCTTCTCCAACACCAGCTAAACCAGCGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTCTTCTTCCTCCAACCTTAGCGGATCGGAAGCGGAACGTGAACTACGTAATGTATTTGTGGCAGCG
NNNNNNNNNNATCGCCCGACGACATTCGGAGATTAACGTGCTACAACAGAAGAGAATCGTCAAGAATATAGTCCGGATCGTATCGCGTTTAAGAAATCCT
GCTCTAGTTGTGGATCGAAGAGACACGACGATCGTGGATGCTGGAAGAGACATACTTGCCAGAAATGCAGTCGCAAGCGAAATCCATCGAAATTTTTTCT
CTATGTGTGTGCAGCTNNNNNNNNNNGTGAAGAGATGCATGAGAATGGCAAGTACCCCATGGAAGAGCTCTATAACTTGAATCGCAAGTGGTACGTGCCT
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTGATACACTGTTGGAGGATGAAGGACTTAAGCATAGGCGCGATTCGATCACTAACATATGCGATAGTTCTACATTTGTTTCTTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAGGTAAGATATGTGATTGACGAGAGCCAAACGCAAGGATGTGTTGGGATCGG