Description :
From Genome Similarity Track
Location :
Scaffold_1453:2057- 4610
Sequence
2553 bases(100 bases per row)
CCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCTCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGATAAATCCGTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACC
GAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACATGCGATATTCGGTACCTGCCGTTACAA
GCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCACAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGTGGTCGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTATTTATGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACCGGAATGGCCGCTTCTA
GAGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGAGCGGTGTTCATCGCGAAGGGAAGCAGCTCTGCGTA
CTCATCCCGATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGA
TATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGC
TAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGTACTAGCTTTGGCTATCACGTATCCGGTAAACAG
GTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATA
TTCCCAGGTGACCCCCCTTCGATTGTGGGCCTACCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTAC
AGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGTAAGGT
TTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGAGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCC
GTAGTGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCT
GTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATTTATTCCTCTGGACCTAGTGACGGCCA
TCACCTGGACTGTCCTTTTCCTGGATCCCACTACCACCACTTCGTCTAGTTTGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAAC
ACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCGAACCACGCAGG
TGGATCATCACTTTCTGCCGTAACAATGTTAGGGCCGGGGCCTTGCAGTCCATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCA
CCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATATGTGGATCT
GGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCCTAACTCAGGACGTAC
AGATCCTCATCTGCCTGGACCGTCGGGATCGAGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTC
GAGAAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGCGTAAAGCTGCCCACTG
TCCCAAACGTCCTTGTAACCCGGCCGACTTGAACATCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCAGATGGATCCTTCCACCAGCAGGTTGTAATTC
AGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTT