Description :
From Genome Similarity Track
Location :
Scaffold_75:205584- 210704
Transcript NameFunction/comments
g12325.t1hypothetical protein
g12326.t1POM68410.1 Hypothetical protein PHPALM_15434, partial [Phytophthora palmivora var. palmivora

Sequence
5120 bases(100 bases per row)
AGCTACATCACCACCACCAACAACAACACCTTCTTCCGTCATCATGAACCTCCATGCCCTTCTCCTCGCTGCAGCCTCCATGACCGCTAGCGCCACCGCC
GAGTTCACCGTTACCTCCACAACGGCCAAAGCCACCACCTCCACCACCGAGCACGTGAGCTTCGTCAAGCAGTGGACGCTCAATGCGGCCACCACCACCG
ACATTATCGACTCCATCGACCTTGACCTCGCCGGCCGCGTGTACGTGAGCTACATGAGCGGCCTGCCGAGCGGCGTGCTCGGATACGTGAACGTGTCGGG
CGACTCGCAGGCTGTTGTGGATGCCGTTACCGCAAGCAATCACGACGCTATCGGCACGAATGACAACTATTATGCCAGCCATAATGACCGAGACTTGTAC
GTGCGTATCGGCAACAGCACGTCAACCGCACTCAGCGGATACCTGCTCACCGAGATCTTCTTGGCTTCCAGCGGCGTCGTGACGGACGTGACGAGCCAGC
GATCAGCCCAGGTGGTCGTCGAGGACGGAGTGTTGGTGTCGAGTAGCACCACTGCCGAACTGCAGGTCGAGGCGAGCGGATCCAGTGCCGTGTACGTGTC
GGCGGCCAGTACGGCCGTGAGCGTGCGTCAGTTGCAGTTGGACGCCGAGGGCTCCGCGAGTCTCCAGTTCAACGTCAAGAGTGTAGCGGTCACGGATGAG
GCGCAGCTCGATGCGCAAGGCTCAGCGACCATCTCACTCCTGGGTTCGTCACTCGAGGCGGCCCAGCTGCAATTGGACGCGCAGAACACCGCCACTATCT
GCATCAGCGGGCAACAGGTCACGGCCACCAACTATGATGGCGAGGACTCTACCAGCCGGATCTCCATGCCCAACGCGGCCAGCAAGTACGACTCCACCGG
ATCGTTCGCTTGCGACGAGACCAGCGCTCCTGCCCGTGAGCCATCGTGTGTGTCGACGGCTTGCGCTGCGTCGTCAAGCTCGGGCAACACGGTGGGGGTG
GCCGGTAGCGGCACACAGACGACGACGACGGTGACTTCTGCGCCGGCGACAGCCAACGACGATGACACCAGTGACGATACGAATGCATCTTCGACCCCGC
GTCTCGCTGCGCTCGCGGTCGGCATGGTTCCTACTGTAATTGCAATGTTGCTGTAGGCGTTGAACTAGACCTTCGGCTTAGCTACCGGTAGACTATGATA
GCTTAACGCAGCTCTTAATGTTCACACACAAGTACATTCCAACCATTTCATGCGTGCCTCGTTCCTTTTCAGTGCGGCAGACACGAGACTGTCGCTCCGA
AGAGGCGACTGACAGTCATGAAAAGATCTGCTTGAGGTGGAAGTTGCAAATCTATGGCGTGTGGTGTGTTTTTGGCTACACAGTGAGTGGTAGAGCAGCT
TTACCTTTACTAAAGCTGCATCATGATGCGTGAGAACCGGCATCATTCGTCTTAGACGTAGACGATCCGTCTACAAGACCGTCGGCTCGATGATCGAGGG
CCTCGGCGCGTGATCGACCATCAGAGTAAGTGAAGTGAAGTTCGCACTGCGGCAAGATATTGAATCTTCAAGTGACTCGATAGTACAGACTAAGGGGGTT
GGCCGACTACATATTGTGCAATATTCCAGCAGCCTCCTGCCGTGAGGTAGCTGAGTCATCGCCAAACTACGGAAATAGTAAACTCTTCATGTCCAGTAAA
TCAAAGCAGCTCCGTACCGGTAAGTGAACCCAAAGTACGGTATTAGTCGTGCGACACCTACACGACCGGATGAAGCGTAGTTGATTCATGCGAGAAGATG
CATTCACTCAGGCTGCTGACAGGCTGTCTGGGATTTGATGCGCTGAGTGAGGCCGGGAATCAATTAGCGAAAATTGCAATCAGTGTGATGGTCTCTGTTT
CCTGTCTAGCGGGTTTCAGATCGACACGAATGGCTGCTGCTGCGAAAACAACCTTTGCCACCCCATGAAAACATTCGAGCAGCGCGATTTTGCTCACTCC
TCATTCTTCAAAACACCAGCTAGTGGCCAAACCCCTTCTCCTCTTTGCAAGCGCTCCGACCGCGCCAACGATGGTCTCCAACGTGCATAATCTTCTCCCA
GTCCTACTCATTGTGCTGGTCTCGTTCCTCACGGGCACCGAAGCTGACTCGGCCTTCTCGGTGTCTTCTGCTTCAACGGAGACCGTCGACTCCAGTACGG
AGCATGTCGGCTTCATCAAGCAATGGACACTCTCCGGCACCAACACGGACAACAATGGCGATGACAACGACGACGATGACGATGACAGCTCGGACGATGG
AGACAATAACAGAGTCGATTCGATCAAGCTGCAAGTCCCTGGCCGCGTCTTCATCAGCTATGTCAGCAGCATGCCCTCTGGTGTGCTCGGCTACGTGAAT
GTGTCAGGCGACTCGCAGAGTCTCGTTGAGGCAGTGAAAGTCAGCTCCAATGACGACGACGAAGAGTTGGAAGTGAAGTACGACACCAGCAGCTCAAGCT
CGTCAGGGTACTTGCTGACAGAAATCTTCTTAGTGACGAGCGACATCGTGGACGACGTCGAGATCGAGTCGTCGGCCGAAGTAATCATTGAAGACGGTGT
GCTGATCGCCAGTAACTCCAACAAGGAGCTGCAAATCAAGGCCAGTGACTCGAGTGTCGTGTACGTCTCAAGCGCAGCCATGACCCTGCAGGATCTGAAG
CTGGAGCTCTCGGACAGCGCAACGCTGCAACTTACCACTGACAGCATCTCGGTCCGCGAGGACGTCCAGTTCCAGGCGCACGACAAGTCTTCCCTCACGG
TGCTCACGTCCTCACTCACCGTGGCCGATCTCGACCTCGACGCTGAGAACTCGGGTGCGATCTGCATCTCCGCTCAAGAGGTTTCGGCCAGTAGCTACGA
CGGCCAAGACGCCAGCAAGATCTCGCTGCCGAACGCTTCCTCCAAGTACACGTCCACAGGCACAGCCTCGTGCAACGAGGCCAGTACACCGTCTCGCCAA
CCTGGTTGTGTGTTCAGCAGCGCCTGCTCCTCGATGACGACCAGCACTTCCAGCACATCTACCAGCACACCAAGTGCCACCTCAGCCACCTCAAGCGCTT
CCAGTGCCACAACGACGTCATCATCGTCCGGTGTCAAGACGAGCGAGCAGAACAGCGCTGCGGTCGGGCTCTTCGCCTTCTACTCTCTCAGCATGGCTCT
CACCACCAGCCTCCTACTTGCAGCCTCGCTGTAAGCAGGCCACTTCAACATGACGTTTCGGTGGTCGTCGATTACTTTCTTTTCGTATTCCATACGAATT
CGTACATTGTTCACTGTGGTCCACCTTATTTCGCGTATCATACTCCATCCCCCCTAAAGAGCGCCATATCCAAACGCTCAGGGTTTTGTGTCCTCGCCCG
CTGGTCGCCCCCGTCTTTCCCGTCGCTTTCTCGCTCTCCCCTGCATCTCAGCGCTCCGTACGTGACCTCATCTAGCTTTCTCTCTCTCCTCTCTTCACGC
ATACCGGTCTGCGCTCAATTGATGGTGTTGCCGCGCTGTAGAACTCATTTTAACATGCGCCACCGCTCTGTCCTATAAATAGTGTCCCAATGGCCGCGTG
GCCACAGCCGCCTCGCTCACCCAATCACAATGGGGGACGATTTGAACCGGACACAGGGACCTTCCAGAGTCTCGGCGCCTTCGGTCACGACAGCTTCCTC
GGAGGCAGCGGTCAGCTCAGTGGCGGCCTGGAGTTGGGAGGCTTCGGCCTGGGGCTCTCACCGCCGCCTCCGCCGGCTTCTGGGGGCCTCGGATTGGGTC
TAAATCAGCAGCCCCCACCATTGCCACCATCTTCTCCTGGTCTCCTGCAGCAGACGGAGGCTGGCGGCGCGCTCTACCACTTGCAGCAGCAGCAGCAGCT
TCAGCAGCAACAGGACTTCGCTATGGGCCCCGGGTCGGGCTCCGGACTGAGTTCGTTGGCCTCGCTAGGAGGTCTGGAGCTCGGAGCACAGAGCAGAGGC
GAGTTCGGCCTGGGCTCTTCCAGTCAGGGACTCAGAGGGCCAAGACTTTCAGCTGCAGAACCTACAGGACCTTCAATCTCGGGCAGAAGGGGGTTCGACC
TGTCGGACGCCATGCTCAATCTGGACTTGAGTGGAGGAATGCTGGGCGAACGTGGGGTGCTTGGTGGGAGTGGCGGGTGGGGAGACGTTAGCCTCTCGTC
CCCGTCGCCCTCGTCGGCCTCGCTGCGAGACCAAATGAACGCACAGATGGCTGCGCTGTACCAGCATCCCAAGCCCCCGACAAACGACCGGTTGATGTTT
CAGCAGCATCAGCGTCAGCCGCTAGCCCAGTCAGGTAACGACTTGTTGGGTTTGCTCAATAACGGCAACAATGGGAACAACTCAGGTTTTGGTGGTCGCG
AGCTGTACCCCCCACCGAGTGTGAATATCCCAGGAGGCAGTATGCAGTCTCCCCGGCTAGGAGGGTTTCCAGGCTTTCCTGCTTCCAGTCCAAACAGCAA
CGGGGGCCACGGAGGTCTCGCACCTACCATGTCGCCCTCACGGGGACCCCACTCGAGAAGCTCGACCCCGTCGCGCTCGCGTCGTTCACCAGCGAAGTCG
CCTCAATTGCATCGCGAAAACTCAGCTCCAAGCTCTATGTCGGGCGGCCAGGGCAACTCGATTCATGTGTCTCCTGAAGTGACGAAGCCCAACGATAACA
TCAAGGTTCAGGTTTCTCTGCTGGCGGAGGAGTGCGTGGTTGGGCGTGTCCTGCTTGTGGGGCTTTTCCGACTTGGACAGCCTACGAACGACAAACCCAT
CTTCGTGAAGCAGGTACTTTTCGAGAACAAGCTGCACCGCAACTACCGCTTCTTGAACACGCGTATCACATTCCGCGCGCCGCGTTCTCCTGGTGAGTTT
GAGTTCCGCGTGTTTGAAGACAAGAGCGGCCACAGCCACCAGCCGAATGGAAAGCGTTACTCAAATGACGATCATCACGACAGCCACCATCATGGAAAGG
TCTCTTACTCGAATGTGACCATCGCCCGCAGCAACCGGCTGAAGGTTTGCCTGGAGTACAGCCACTTCATCGATACTTTGCGCGCGACGCATGACAAATT
CCAACAGGGAGTGATCGACG