Description :
From Genome Similarity Track
Location :
Scaffold_64:205555- 211833
Transcript NameFunction/comments
Phyci_230386AlNc14C182G8248
Phyci_230397hypothetical protein
Phyci_94188protein pelota
Phyci_94190Hypothetical protein

Sequence
6278 bases(100 bases per row)
ACCTGGTGCTTTAACTGTGTTCGTTCTTCCCATGACGCGTGACTGATATATATCGCGAGTTGCTCTCCAAATCTTAGACAAATCGCATCCACTACACGTT
TTCGATATGCTTGAAACTGGCGGCACTGCTTTCCAGATCAGCGTTCAACCCCGCAGCCTCAGCCATGCCAGTGGCACTGGGACCCGACCGAAACCACTCG
AGAGCGTACTCCTTGTTCTTCTGGAAGCATAGGTAGGCCTCCACCATTGCTGCATTATCAGCCAGTGCAGCCTCACGCGCAGGACCTTCTGTACGCACGA
GCACACTGTAGATGTTGCTCCGGACAGTTTCGCCACTTGACGACGCCGCTGGTAGCGACAGCACCATTTCAGCGTAAGGTGCAATAAGCGGAAATCGCAG
CTGATTTGTCTTCCACCACGTCAATGGGTCCACATTGCGCTCCGACACAGGAAGGCTCAGGAACGCACTCAGTTCCTTCTCCCATGTCGCGATCATCTCG
TTCTCGCCCTGCAAAGACGACTTCGACTCGGACGGAAGGTGCGAAAGCAGATCGTCATCTTCATCATCAGCGAGAGACACGTCGTTGCTCGTTGGACTGA
CCGAGTCCTTTCCTAGCTCTACATAAGTTGCCGCGGCAGCTTCGGTTGAGGACTGCGGATCGCCATCAGACGTAAACATCTGCCGAAGAAACTCCTTTCC
GACGTCACACTCGGTCTTGGGGGACAAATAACAGTATTCGCGGTTCTTGTATCGCGGATCAAATAATGTGGCTGCGTAGCAGACCGGTGGAAGTGTGGCG
AACTGCTCACGTAACTTCTTCGCGAGGGAATCGAAAAAGCGCCTCCACGTGGCTGGTTCCAAGTGAGCTGGCACACTCTCCACGGCCGAATTCGCTTGCT
TCTGTGCATACGTGACTAGGGCCGCCGCAATGGTGGAAATACTCGAGATGCCGTTCTTGTTCACTTCCTTGTCACTGCCAGTTTTCTTGCTCTTTTCTCC
CTCTAGCGCCTCCGAGTATCGCGAAAATGGCCGCAGCTTCTTCACTAACAGACTGATGAATTCCACCGTCGATGCCGGTAGGTACTCCACTAAATGTGCG
TTTGCGATCTGCTCCAGTGTGGGCAAGTGCTCAAGGAAATCGCGCAGGAAATCGTAGTAGGAAATGGACTCTTGTCCATCTGGAGAGAGTTCGATGTTGA
AGAGTGGGCACTTCCGGCTGAGGGCCACCATCGCCTCCTCGCTCTCTGTCAGTCGAGCCACAAACTCCTCGACCTGATTCACCACCACGGGGAAGGCCTT
GGCGAAAACCTCCTGGGTCAAGCAGACACGCAGGTGCTGCACCGCCGACGTCAGGAGCAGCGTGCTTTGAGCCGCATCGGGCGAGACGATCCGACCATCA
AAATTAATGGGCACGAATAGCGACGGGAGGTCAGAAGCAGTGAGCTCGACCTTGTCGGGCAGCTCGTCCTTGACGCAGGCGATGACCTTGTCCTTGATGC
CGAGGCGCTCGAGGTACGAGTCCAGAATGGCCTTGACCGTCTCCAGCCCCGCCGCGTCCTCGAGCGGGGCCACCCCGACGGCGATGTCGAAGAGGCGGAA
GTTGACGCTGAAGTGGACCTTGACGGCCAGGTACTGCGTGGGCTTGGGCTCCACCGTGGCCGGGTGCTGCCACACCTCGAGCGACACGGCCACGCTCTTG
GCGCGGGCCAGCACCATCTTGGTCGTGAGGAAGACGCTCTCCTGCAGCAGCAGGACGCTCTTGGCCAGCGCCTCCTCGGTGGGCAGCGGCAGCTTCTTGT
CCCCGAGCAGCTGGTTCAGCACGTACTGCAAGCCCGGGCGGGCCGTGAAGTCCAGCGGCAGGTTGTCCATGAGCGCCATGAGCGCCAGGTCCTGGCCGAA
CTGCTCGGCGTTCACCTGCGCGGCCTGCACGCCGTAGGCGGAGCCCAGCGCCTCGCGCTGCTCCTTGCTCATGGCCGGGTACGCGTACAACGCGTCGCGC
TTGAGCGCGGCCGAGAACATGCTCGGGGAGCcgccggccgcggccacggcggcggcggcggccagcgcctgcgaggccgcgggcggcgcgtacacggcga
agtcggcggcggcCGGGCCCGCCGCGTTCACGGCCTGCAGCCCGAGCTTCTGGCGCTTGAGGTGGCGCTTGGTCTCGCGGTGCTCCTCGCACACGCGGTT
GGCCTGCTCGTGCGCGCTGTCGGTGCGGCCGGCCGTGCGCAGGTGCGACAGCAGGTTGGACGAGTGGTGGCCCTTGATCACGCGCTCGCAGAACTTGCAG
ACCGAGTTGCCGCCCTGGTCCTTCTCGAAGTACGACCACACGGCCGACACGCTGGCGGGGCCGCTCGCGTGGCCGGCCGCGGGCGTGGACGGCGCCGAGG
ACGACGCAGCGGCCGCGGCCGAGGCCGCCGACACCGCGGCGGCGGCGAGGAAGTCGCTCGTGCGCGCCGCCTTCACCACCATCGGTACCGGTAACGCCAC
GCAGGTATCGGTACAACTGGCGCTGGGGCGAGACTTCCCACTACTAAATTAGATGTCGCCCGGCCCGAACCGCGCGTCATCCCTCCTCACCGCGAAGAGT
GACAGGAAGAGTGACACGGATGATGAGCTTCAAGGGACAGTGAGGTATCTGCTTTACCAGCGCCGAGTCTCAAGTCTCTCGTGGCAGTTGGCACTTGCTC
GGTTGTCAGGTCCTGAGTGCATTGAAGCCATGCTACGTCGAGCTCATCTTCGTGGGATTGCGTTGATCGGAAGCCGGAGCTTCTCTGGTTGAGCTTAGAT
TTCATGCTTGTCACTCTTGTCGTAGGAGGATGGCCCACTGCGTGCTGAGCTTTTTTTTCCTCTGTGATGCGTGCAGCTTCGAGCGCAACGTCTACGGTCG
GCTTCATCGGCCTGGGCAACATGGGCTTCCCCATGGCGCACAACCTGCTGAAGGCGGGGGTCGACGTGCTGTGCTTCGACGCCAACCGCGCCAATGTCGA
TCGGCTGGAGCGGCTCGGAGCCAAGCCCGCCGACTCGGTCGAGCAGGTGGCCGCTCAGACGAGCACGATCTTCTCAGTGCTGCCCAGGGACGAGGTGGTC
ACGAGCGTCGTGCTCGGAGACGAAACCAAGCCTGGCTCCGGTCTGCTGGCCAACCTGGCGCCCGGCGCGCTGCACGTCGGCTGCTCCACGATCCACCCGA
ACACTTCGCGAGCTCTGGATGCCAAACACCGCGAGGCCAAAACGAGCTATGTGGCTGCGCCGATCTTTGCGCGACCCGACGGAATGGAGGCGCTGCAGGC
GAACTTTGTGCTGTCGGGGTCCGAAGCGAAAGCTGTGGAGCAGGCAGCCCAGTGGCTGCACAAGTGCACGAACGGACGCGTGGCGCCATTCAGCACGGAG
GACCCCGGCGCCGCCAACGCAGTCAAGCTCTGCGGGAACTTCCTCATCGCGACCGCCATCGAGTCCATGGCCGAGGCGCTCTCGCTGCTGGAAGCCAACG
GCGTGGATCGCGTGCACGCGATGCAGTTCTACAGCAGCACGTTTCTCAACTCGGTGGTCCACAAGGGCTATGGCCAGCGGGTTTCCGAGCGCGACCACCG
TCCTGGAGGCTTTGCGCTGGAGCTGGGCTACAAGGACCAGCGACTGGCTCACCAACTGGCCATGGAATCCCAAGTGCCGATGCCGTTCCTGTCCACGCTC
ATCGACCGCTTCCTGAGCGAGCGCGCCAAAGGCCGCAGCGACCTGGACTGGTCCGCCATCGGCCTCGGCGTCTGCGAGTCTCGCGGCGTCGATGTCTCGG
AAGCTATCGACCGATCTCGCGCAGGACAAGCGCCACCTCCACGTGGTCACCCGTAACACGCGCAAAATATCGCGTTGGATGCACGCAATACCTGCCTGGA
GACTCTCGATCCATTCCTTCTGCCTCTCCTTGTGCTTGGCCGGGTGCAGTATTATGATGCAGGTGCAGGCTTTGCTGGTCACCATACCGGTATATTACCA
CCGTGTTTTGGAACTAACGTTAGTTGAAGTTGCAATCCATCGTCTTTTGAGAACTGGTGTTACCTTCGCGTTACATGGAGTACCTTCGCGTCACATCCTA
ATCGAGTCCGAGCCATTTCGGGTATCGGAGGACCAGGATGAAGCTGCTCAAGAAGCAGATCAGCGAGAAGGATGGCGCCGGCTCCGTGGTGCTGCGCGCC
GAGGAGCCCGAGGACATGTGGCATATCTACAACCTCATCCACGTGTCGGACTCGGTCAAGACCACGACGATCCGCAAGGTGCGGCACCTGCAGCGTGAGG
AGGGCGAAGCTACAGCAACCCTATTTCGTACTTAAGAGAATAATCGACTCGTTATGGTCTCTGCAGGTGGTGAAGGAAGGCGTGACGGGTTCCACCAGCA
GCCAGCGTGTGCGCATGACGCTACAGATTGAGGTGAGCTACGGTAGTTGCTGTGTTCCTGATGTCAGAGCTGCTAATTGATAATTGGGTTGATGATGATG
ATGTGTAGGTGGAACAGGTCAACTTCGACCCAGTGCTCTGCGTGCTGCGCATCAAGGGCAAGAACGTGATGGAGAGCCAATACGTCCGGGTATGACAACG
GTGATATGGTGCCCATGTGCTTGAGGGCTGGTGTACTGACGGGTTCAATGCTGTAGCTGGGAGCTTACCACACGCTGGATCTGGAGATGAACCGCGACTT
CACGCTGGCCAAGAACTGCTGGGACGTCATGTCGCTAGAGCGCATCGAGATGGCCTGCGATATCGCCAAGCAGGCTGAACTGGCGGCGGTGGTGATGCAG
GTCGGCCTGGCGCACTTGTGCTTGATCAAGGGTGACATGACGGTCATTCGCGCCAAGATCGAAACGAGCGTGCCCAAGAAGCGCCCCGGAAGCTCGGCGC
ACGCCAAGGGCACGGAGAAGTTCTACGAGAATATTGTGCGCTCGATCCGACAGCACATTGACTTCAAGCTGGTCAAGTGTGTGCTGCTTGCCAGCCCGGG
TTTTGTCAAGGACGACTTTTTCAAGTTTATGATCGAGCAGGCGGTCCGCCAGGACGACAAGCTCATCCTAGAGAACAAGCCCAAGTTTGTGCTGTGCCAC
TCATCCTCCGGTCACAAGCATGCACTTGATGAGGTACTCAATGACCCATCGATTCAGTCGCAGGTGGCAGACACGAAGGCCGTGGAAGACGTCAAGTGCC
TGGAGCGCTTCTTCAACATGCTGCACATTGACCAGGATCGCGCGTACTACGGCTACAAGCACGTCGTGCGTGCCAACGCGAACATGGCGATCGAGACGCT
AATGATCACGGATGCTCTATTCCGTTCGCAGGATATCGCCACGCGCCGCAAGTACGTCGACCTCGTAGAGAGTGTGCGCGACAACGGCGGCACCGTCCGC
CTGTTCAGTAGTTTGCACGTGTCGGGCGAGAAGCTGGGCCAGGTGAGCGGCATCGCTGCCATCCTGCGCTTCCCCATGCCTGAGATCGACGAAGAGGACC
AGGACGAGGAGTCCGATTCCGAGGAGGAGGAAGACGACAAGGAGGACGAGAGCGGCGTGGGCGACCTGTCCGTCGAGGCTCTGGGTATGTAGAGGAGGCT
GTCAGCAGATAAACAAAAGCATACACGCAGTGCACAACCCAATGAGAGAGAACGGAGCACGGCCGCATTCCGCTTAGCTGGCTGTGTTGTGCTGTACGAC
GAGGTTCGACACGCGCTTGTCGAACGTCTGCGACGTGAGCCGCTCCCCCAGCGGCGCGAACGGGTTCGACATGGCGTTCACGTACAGGCGGTGCACCTCC
GCGAAGAACTGCAAGCACGAAACACACAGCAGCAGCATGAGACCACAGCTCCCAGCCCCGATGGCGATGGCAATGGCGCTGCAGCTCACCGGTCGGAGCT
CCGACTCGCGCACGGGCGCGTCCTGCAGCACCACGACGAACTTGACGGACGTGTTGGTCACGTAGCCGTAGACGCGGTAGTCCTCCACGGGCCCCAGGAA
GCCCAGGTACATGTCGTCCTTGGAGCTGGTGATGCCCGCGCCGCGCAGCTTCTCCTCGATCACGTCCAGCGACACGTGCGCGATGTAGTGGAAGCCCAAG
TCCTCGCCCTCCTCGCCGAACGTGCGGATGTACAGCGGGCTGTTCTGCGCGGCAAAAGAGCGGCAACGTTCTGCGGTTAGTGGGCGATAGTACGCAGGGG
TTCATGGGGCTCGAGACGGCCGGGAAGGGCCCTTACAGCGGCGCCGATGACCGCGACGCATGCGATCATGGTGATGAA