Description :
From Genome Similarity Track
Location :
scaffold_86:20554- 32825
Transcript NameFunction/comments
g3131.t1 conserved hypothetical protein
g3132.t1 ATP-dependent protease hslV
g3133.t1 cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
12271 bases(100 bases per row)
AGTTTGTGAACTTCTTTGTCTCCTTCTGGCAAAAACGTTTTCGTAGCAAACAGTTCCGCGAAGAATGGTGACATCACTATCGGAAGCAGTTCCAAACCGG
GTGAGCAATCGGGAGCACCAGAGTAATAGCGTCAATGAACGGCCAACATAGAACGGAATCACGCGGATACTGATGTGTTGACTCCAGACTTGCCCTTCGA
AAATGACGGACTCTTGCAACTTGGTATCAATTACAAAGAATATCTGGTAGATCAAGGCGACGTGGTCAATCAGCAGGATCCCTAAAATGATCCCTACGAA
ACGAAGATGGAGCTTCAACTTGTTCCTCATAATTGGAGGCAATGCATCCAATGTAAACAACCAATGCGCCCAAAGCCACCAGGATAGTACCATTAAACAC
TGCGGAGGGTCCCAACCATACAAACTACAGACGCAGATATCTGCCGCTGTGATTTGAATCGAGTAAAACATAAAGTCGAAAGAAGAAAACAGCAATGCCA
GCATTTGACGCTGGTAGAAAACAGCAAACAAGATCGTAAACGTAAGGGTGCACAGTAGAGCAAGCAGTGCTCCCAGTAGCTCCAGTAGCTCCATAAACCC
AGTTTCCACTGCCTCGAATAACTCATGAAAGAAAAGGATATGTGACAGAAGAAGACCTATTGCTCCGACAGTGTATAACATCACGAGTAGCCACGTTGGA
AATGATTCTCGGGCCGATTTCCAAGGAAATAAAGTGCTAGAAGAGTCAAATGTATGCGGAAACTTGACAAACAGTAAGTGCTGTACTGTATCGGCTTGTT
GCGGTAATTTCTGTTTCGATGAATCTTTTGAAATCCACGCCGTAGAGGTTCTCGGTTTGTGTTCGGGCTCCAGTTTCAATTTGCACCGATAAATGACGCA
TTCAACTATTGCTGTAGATTTTCTACGGCGTAATCGAAGAGCTTTCCGTCTCCTGAAAATTATTCTTCCGAGGAGAAAACTCAACGACACCAACCCATTC
CCGATTACGTCAAGACCCGAGAGCTCAAAATCCCCATGAATATTCTGGTACTTCATGATGGAAAAAGTCGAGCCTCCGTCTACGTTTCCAAACATGATCC
AGGAGAAAACGATTAAAGCGGAGACAATTGAAGCGAGCAGGAGATACGTCACGGTTTTAATGCCCAGCACGTGTGCGTCGACACATAAGACGTGGTGATA
ACCAACCCAGTCGATCACCATCCGCACAGAGCGGATATCTCCGAAATACATCCACAACATGACGGTAACCACACTGGTAATGATCGAAAAGAACCAAAAA
TCAAACGTTCTGATCGCTAGACGAACAATGTCATAACGCAACGTGGTCACACTGCCCAATCCCAACGGGGCCCATAAGACTACGGCCAAAATCGCAAAAA
TCCGCCCCATTGGTGCCTCAACCATCGGTAATATAGCATTGAGGCAGTAAGAGACAGCCGCGCAAAGCAAGATTTCTCGGTAGTATTTGTAGTATTTGTG
ACGGATGGACGTGTGGACTCTCGCTGGTAGTAGACGACCTCGAAAAGACTTGGATAAGTCGACTGCCGGAAGAGGGTGAGCTGGCACAAGTGAATATATA
ACGCTGCAACTGGTGGTGGGGCTCCCTTTTGCCAACAAAGACATTACTGCAAAACCAGCGCAAGTAGCTGATGAATAAGCAGATGAAGGTTTCAATTCTA
AACTGCACTGGTCCCAACGTGTTCTATTTTTTGCTAATTATCAAGATTGTACTGCAGTAGTTATGAAATGCAAATATTTTTAAAGATCTTTAATAAAACG
ATAGGTATGACTCAAGTGAATCCCAGTTTGTCCTACCGTTTGACGTTGCAAAGGACGGACAGGTTTATGACGGAGGTCTTCGAACTGTCAGATTTAAAAT
CAACGACCTGGTTGAGATTTGAGCTTGTTCGTCTTCCGTTGGCAAAAATATTGTCATAGCAGACTGAGCCACGAAGAATAGTGACATCGTTCACTCCGGA
TGAGCCCAACCTCACCACTAAGCGTGTGCACCACAGGATGAGAGTCAACGATCGACTGGCGTAGAAGGGAATTACTCGAATAATCAAGTGCTGGTTCCAG
ACTGTCCCGTCATAAATGGTTGAGTCTTGCAAATGCGTGTTACCGACAAAGAAAATCTGGTAGACTAAAACGGCATTGTCCGCCAGCAGAACACACAAGA
CAGGCACCGCATAATGGACGCGAAACTTGAACATGTTCCGCATGACCGGAGTCAGCGCGTCCAGTGTAAAGATCCAGTGAGCCCAGAACCACCACGAAAG
CGACATCAAGCACTGCGATAACTTCCATTCGAACAAACTGCAGACACAAATACTTGTCGACGTGACTTGGAACGAGTAGAACGCGAAATCGAACGAAGTG
AAGAGCAGTTTGAGCAACTGGCAGTGATAAAAGGCAGCGAATGAACCGGTAAAAATAATTGTAAAGATCAGCGAAACCCAAGAAGTTATCAGCTCCAGCT
GCTTGTGCGAGGCATTTTCTTCCGAATTACAAAAAGCTTTGAAAAATATTCCATGAGAGAGGAAGAACCCCACCGCTCCTACCAGGTAAATCACCACCAG
AAGCCAAGATGGTAGGGACTCTCGCTGTGAGATTTTACGCACCAGGATATTATCCGCCTTAAATCTTTGGGGAGATTTGACGAATATCAAGTGTTGAACG
GTATCTGCTTGTCGTAAAGAAAGTTCCTTCGAGTCAAACCTCCTGGAATCCCACGCCATGGAAACTTCCGGTCCTTGCAGTTCCAACTTTAATTTACACC
GATAGATGACGCACTCAATAAGAGAAGACGCACTCTTTCGTCGTATTTGAAGGGTCTTGCGTCTTCGGAAGATGATTTTGACAAGGAGAAGGCCCATCGA
CACCAATCCGCTCCCAATTACGTCTACCCCCGAGAGACTAAAACCTCCGTACTTGTTCTCGTATTTTACGACGGTAAATGTCGATCCTCCATCCACTCGC
CCAAGCATTATCCAGATGAAAACAACCATAACCGACAACATTCCGAAAATTAGGATATACGTCAGATTGCGGAGACCTAGAACGTGGGCGTCGATGAAGA
TGACATGATGAAAGCCAAACCAGTCGTTAAGCGTGCGAATCCATCTCATATCGGACAAATACATGGAGATGGTAATGACAATTATGCTTGTCACAGTGGA
GAAGAACCAAAAGTCGAAAGTCCGAACAACAAGACGTACGATATCGTATCGCAGGGTAGTCAGACTACCAAAGCCTGATGGCAACCACAATAGAACGGCT
AAAACAGCAAGAACTTGCCCCACTGGCGACTGCACCATCACCACCACGAGATTTAAGCAGTAAGATACCACCCCACACGCCAAAATTTGTCGATGATACT
TGAAATATCGACGTCTGATGTATGTGTGGAGTCGTGACGGTAAAAGGCGACCTCGGAAGGATTTCGATAGATCCACAACTGGAAGAGGCTGGGCTGGCAC
CAGTGCGTATATCAAATTGCTGGGTGTATTCCTCATTGTCAGAGGGGCGTTAATCACAAGCTGCGTCTATGTGCTCAGTAAACCGAGATTCAGAGGGCTC
GAAATAATCAAGCCATCCAAAGTTAGCTTCTGTCACCATTGCCTTGGCGTCACCATTTTCTAAATCTTGGGCATTAGAGATAATTCAAAAATACGCTTCA
AAGCCGAGTGCTGGATACTGAGCATCTAGCTATTGATAGCGTTTACTCCGAGTCCGTGCAACGTCCTCACTCCGTCTCCACTGTACACAACCTGACCGGC
CTCACGACAATTCGCTGACGAATCGATCGAACACGACGAGAATGCCTTACGAACCTCGCCGTCCGTCCAAAAAATCCTTAGTGATGCACCACAGAGCAAG
ACCAGCGTCCTCCGATCCACGATCAGCTTCCGAAAGACAAGGAACTCCGACTTCTCCGTTTCCCACTCGTCTTGGTCTGTTCTGGAGACGAAAACCAACA
GTGACTCCTGTAGCCTTGCGGTCCCTTGTAGTGGCAGAGCAGCACGCGACTGGAAACTCGCTTCAACATGACCCGAACGACAGCATCGTGTTCCTTAACA
CTCCAATCGAGTTCGATTTGCGCTCGTATTTCTTCAAGAAGCAGAAATCGAGCAATACAACGGAAGGTCTCGAGCGCTCGGCGATCAGCCAAAGATCCGC
TAGCAGTCGTCGCAGTCAAACGAACGCATTGACATCCATGGATACGTCATACACAGGGGATCAACCGTTTCGAACATCTGCAGTCATGAGTCCCAGCAAT
TCATCCACACAGCAAACGAAAAAGCCACGACGGAGGCTGCGTGCAAGCGAAGAGCTCTGTATCGTGCTGCCTCGATCAACAAGTCGAGGACGGACGAGAT
CGCAGAAGTCTTGGTTCTTGGGGCCAGGGTTCATCGGACGAGATCCAGCAGAAGGAACTTTTGTCGCTACAAAGGACAAATCTATGGACGCTGTGCACGC
CGAGATCTCTGTAACCGGTGATGACTATTTCGTACGCGACGCTCAAAGCACAACCGGTACGTTCCTTTGCTTAAGTACCCGATACAGGCATTACCCCCAG
CGAGATGGATTTCGTCTGCGTAGTGGGGACATCTTTCGCATTGGACCAGCTACTTCCATTCGCGTTGAAGACTTGCAAACATCCATTTATCATACTCCCC
TTCGTCATATCAAGTCTCGCTCTAGTTCAAGCTCAAATCTTGAACAACTTGGTGTAAAACCTGAAGTCAATAACACTCCAAAACTCGAACGAACGCCCAG
CACCAGCAGTGGGACATCAAAACCAATGTTGAAGCCGATGTCAACCGTTGAGAAACTTCGTCTACTCGCTGCAGATAAGGAGGACGAACTCAATCACAAC
AGACGCCCCTCAATTCCGCGAAGAAACAGTCTCGAACGAAAGCCACAACATAATGTCCACTTCTCCGATACGCCTCCCGTCATGTCCGATGGCTCCATTT
TCTTAGGTAGTCGTTATCTCCGATCGGAAGTGAAAGAACTGCATTACCACGAGCCTTCCCAGGTAGAAGATGCCGACGATGACATGGTCCAGAAGCTAGT
TGGAAGTGACCATGATCCATCACCGACAGAATACTCCAGCTCACCAATCAAAACCCGTAAACCTGTATCGCTTCGCCTCGTTATTTTCCAGCACAACCCT
GCCAAAGTCAGCACAGAGCCTCTCCAGCCTCAAGATGCTCGCGAAGTGATTTTACCAGGTCAACAGTCGTACCTTATAGGGTCTTCAGCAGCGTGCGACG
TGCGCATTTTCCCCTCCGAAGGCATTGAAATCCACGCTGTGCATGCTCGAATCGTCTTCGACGGCGTATCCTTCATACTTCAGGATGTATCCTTTGAACG
GGATCCACGCCGACAAACACGCGTTCTGCTGGCTCAAAGACCGGTTAAAATCACTCGAGGAGATTGGTTACAGCTCGGTAAATGTGCGTTGTATGTCACA
ACGGTAGCAAGAGCTTTTGGTTCGGAACGACGACCGGATATGAAGGAGGCAGCCATGCGCTTGGACGTTTTGCGTTTATCCAAGCGGAAACCACGGACGA
AAGGCTTGTTTGTCCCTGTAGGCTTCCGGTTGCAGTCCGCCTCGGGTTCTGGGGCATCCAGTGGGAGCAGCGGCTGGGGTGGCAGCAGCGGTGGACCTGT
TACCTTCGGTAAAGGCCGAGACTGTGATGCTCAAGTTTTCACAGCGTCTTTAGCTACCGAACAATTCTGTGTGCAGCTCGAGCGGGGAACCTGCCTGCTC
ACTCCGAGACCCACAGGTATCAACGCTGGTACGTATTTCCTAATCGGTCGCGACGAAGTTTATCCATCTCTTGAAGTTGACGCCTCGGACGACACTGAAG
AACCAAAAGGAGCCGAAATTGTCAAGCACAGCAGTAAACCGTTGTTGCTCTCTGAAGGGTGCGTGTTCCGGTGCGGTGGCAGTGAGATAGAGGTCATCTG
TGTGAAAAGTACCAACGGCAGGGGCTCCTTGGAACAGCAAGAGCACATCCGGTTTCTAAGCGCCATGTCGTGGCTAACACCAATCGCGACTGACTTGAAA
ACGATCACTGTCGTCGCGCGCTGCGGTCAGCGACTCAAGCTCAATGCAGGTGACTTGGTCTACGAGAAAGGGGACGTCGCAAACTTTGTCTTTATCGTGA
TACGCGGTGACGTTGATCTTCTGGAAACCGAGCATGCTGAAGAGAGCCATGGCATCGAGCAAGTGTCTCTGGGAGGATTCTTTGGAGAAGAGAGCTTGCT
TGACCCCTTGGAACAAAATTCTTCAACGCCACACACTGACGATCTGGAGTATACAAATACTGCGAAAGCAGCTAGCGCTTGTGAACTGCTAGCTCTGGCC
AGAGAAGATATGTGCGGGTATCTTGAGTTGTACATGGACATTATCCGCGCTCACTTGAAACAGGATCGGTGTCGAGACAGGATTATCCGTGCAGCATGCG
GTTGTATCCCTTGGCTACAGGACATTTCTCTCCAAGAAATGCGCCAGCTTTCAGCCCACGCAGAAGTCACTGTGTATCCACCTGGATCGACCTTATTTGA
AGACGGGAAGCTGTTTGTACCTGCTGCTTTTGCTGGTGGTAATACGTTTCAACTTCGGGACGGGCTCCTTGTGCTCCGTCGTGGGGATGCACGGGTTGTG
AGAAGCAAGCATGAGCGACAGCACCGACGAAACATGAAAATATACCATGCCAACTTTGAAGAGGAACATCGGGACCTTGAAAGTGTCGATGATGAACCGG
ACGAGTGGTGGAGTCCCATGGAGCCAGTGATTGCCATGAGCTCAAGGCTCTCTGAGTCGGTGTTGACTTTCAGCGATTTGTCATTCCGTGTTGAAGCATG
CTCCACAGTCGAGTGCTTCTTCATTGCCGCAGTTCATCTTGAACACTTGACAGCGTCCAAAGAAGAGAAAACTGCGAGTTCTGGGCCTGAAGCAGCAACT
CTCGCCCAGATTTCATCCCCTTTAAAACGAGGCAACTCACACATGGGAAGACGACTGCATCATTCAGAGGTAGTCACAAGCGCACTGCATAATGACGGCA
ATACCTGTGAAGACGAAGATTCCTCAATGGACGGGTCGGACGGGGAGGGAGATTCCACAGGTGCACGCCGATGGAGACGCAAGAAGCGCAACAAACACCT
ACTGGAGGAAACCGTTCTAGAGACACAAAATGACGCGCAAATACCCAATGCGTTAGTCTTGTACGTACTGGCGGGGGCGCAACGGGGAGACATCCACGTT
GTCCGTAATGTGGCATCCATCGGTGGGCTTCTTAGCGGGGCTGACATCGAACTCAATGACCGGTATGTCTCTCATACGCATGCTATCATTGAGTACCATG
ACGGCAAGTACTGGCTTTACGATAACGGCAGCAAATGGGGGACATTTGTGCGCCTGGAGGAAGACAACGCTGTCGATATCAATCCAGGAGATATTTTCCT
GGCCGGAGAGGTTGAATTCACTTGCCTTGCTGCGTATCCCGAGCGCAACAAGCCCAGCTTGTGCTGTCTAATGTAACTAAACCGCAGGAACACTGTGAAA
AAGACGTGATTAGCAATAACATGTAAGATAAAACATCTCGGGCATTCAGCTTTTCACCTAGTCAACATTCTTGCGTGGAGACGCAGGTGGCCCAACGAGT
ACATGCGCCAGCACATCTGCCTGTGCGAACTCCTGACCTGATCGGATATCAACGCATACTGGGCCACCCAACGCCTGGAGTCCACCCACAATTGGCAGAA
ACTCCATCCACACGGTCTTCATAGTCTTCGCTTCCATTACATCCAGGTTCTGGTAATACAAAACATATAAATTAGCGACAACAGGCTTCGAACCAGTGAG
CAGATAGCATTAAACGGTACCTGATGAGATGCAGACGAACACACAATACCGTGCATCAGTTCCTTGCGGAATTGAAGTTGCAGCGCCATGGTTCGAGTGG
AATTGTTCGTAACAGATACAGCAGCCAAGAACGGTTGTCCAACAATCACTTCCTTCGGCAGTTCGTCCACAGATATCGTGACTTCACTGTGCTGACCGGC
ATGGCCAGCCCCAGGAATCTTCCTCATCACCGGTTGACTTTGCACGGATCCAGCTTCGCCCATTGACGTTTTCCATCCCACATGAAGTCGGCCAAGATTT
TGTGATCCCTATATAATACATAATGCAAGGGTCAGTACACAACAGACGAAATGAAATCAGGGAATGCTTTGTACCTGTGTCGATAGCAACGAAGGGTCTG
ATGCTGGATCATAGGCCACTCGGAAGACGCGCTGGAGTTCTTCCTGAGGGTACATGAGCGTCTGCGGCCCGTTGTTCGTCGACAGCAACTCTTCGATCGA
CGTTTGCTCTCCTTGTTTCTTGGCCGCGTTTTGTTTATGCATCTCTTCCGATGTAAATGGAGGCAGCGGCAAAAACTTGATACTGTCCACAAACAGCGGC
ATTTTGGACACATTTCGAACTTGAGCCTCCACAATAGCCTCTCCCTGTTGCTGCTGCGATGCTACCGAGTGCTGCTTGAACGTAATCACCAGTGGATTCT
GCACTGCGAACCGGTAGAATTTCCGTAGGGACTTGTTTTCGCCTGTCACTGGATCCACATAGGCTACGCCCACACGCAGCACGTGATTCCCGACTTGGTT
CAGTGGGTAATCCACTACCATATCCAGACTGGAGCCAGCAGTCAGCACTGCAACAGGATTGGGGGGAGGAAGCTTCCCTGTTCGAGCATAGCGGTTGTCG
TGTAGCTCCACCCGGTCATTGGCGCATTGGATATTGGCCGACAGTCCAACGTCTCGTAGTTCACATGTGTACGGGTTAATGACGCTGATGTAGCTGCTGA
ATGTGTTGCCCAGGAAGATCTCTCTAAAATGGAATAATATTAAAAAACAATATTCCAATTACTAAAAAAAAATAATATCATGGACGTACCCGAAGCTATC
CGGTAGAATGAGCATACTAGAGAGCGCAAATTCATGCTGCATAGCTGTGTCTTCAGCCATCGACGTGGGCAGCATAGAACCCCCGCTGGCTCCTTGCACG
TACAGCTTAGGCTTGTAAAGCCGCATCACTAGAGAATTTCATGATAAATAAGAGATTTTTACACGCGAGAGAGACAAAATACAACACTACACCTTTGAGT
GTCGGCTGCACAGTCGGGGGAGGTGGGGACGGCACCGGTGGAGCGCCCCCACCGGAGGAAGGCGGCCCGCTAGTCGCGTACGCGGAGCTCATGATCCAGC
AGAGATGCTATTGCGCAATGTTGCGGCAAGAGCTGAGGACTTATGTTGCTCGCCTGCGCTTGTTCACAAGATCGACAATGTCGCGAGAAGGTTGCTTGTA
GAAGGCAAAGCTTGTGGTCAAGCTCATTTACAAGCTGAGGAAGATGCTGGCTCGCTCGCTGTTCCGCGCTGCCTCGAGCGCGCGTACGTCGCCGTCACTG
GCCGCCGCCACCGCCAACTTCGGTGCCTCGCAGGTCGCTCACTTTTCTGAAGCCCCCAAGGTACAAATTCCATCCGAGTTACACGTAAAAACCGTGTTTT
AACGTGTGTTCTTGGGTGTTAGATGCGCGGAACGACGATCCTGTGCGTCCGTAAGAACGGCAAAGTGGTGCGTTCAATGAAGTGCTGTAGACTTGTTATT
ATTATTTAAAGGGGTGTTCATCTGTGCATTTATTCTGGCGTAGTGCCTCATCGGAGACGGCCAAGTGTCGCTGGGCAACACGGTGGTCAAGCCCAACGCC
AAGAAGGTGCGTCGCATCGGGGAGCACATCGTGGCGGGCTTTGCCGGATCCACGGCCGACGCCTTCACGCTCATGGAGCGTCTGGAGGCCAAGCTGGACG
AGTACCCTGGCCAGCTTACCCGCTCTTGCGTGGAGCTGGCCAAGGCCTGGCGGACTGACAAGTACCTGCGTCATCTGGAAGCCCTCCTGATCGTCTCGGA
CCTCAAGCAGTCGTACACGCTCACGGGTAACGGAGACGTGCTGGAGCCCCATGACGGCATTATCGGCATCGGCTCGGGAGGCTCCTACGCTCTGGGTGCG
TTTTTTTTGGGGAGACAAATGCAGGATAGCGAAGATGACTAATTGGTGCATTATTACGTGGTGATGTAGCTGCTGCTCGCGCTCTTATTGACCAGGATTT
GGACGCTGAAACGATCGCACGCAAGGCCATGAAGGTTGCCGCCGACATTTGCATCTACACGAACGAGAACTTTGTGGTGGAGATGCTGGAGGAGGGCAAG
GACGACCTTGTCGAGGAAAAGAAGGAGTAAACGACGTAGCTTTTTGCATCAAGCTTTTCAGCAAGGTGACGTAGAATTATCGTACTTCTGCTGCAAATGC
CGGACAGTAAATAAACGTGCAGAAGCTCAAACGAACCGTTTGATCTCGTCGTCAAGATAATTGAGTTGAAGCGTGTGTAGATAAAGGATATCATATGATA
GTCATAGTCGAGCAGAGGAAGATAAGAGAACGCTAACAGTAGTCACAGAGGTAACTGCATCGACGCTACCCCGCCCGATAAATGGGACGCGAGCGTGTCT
GCTTGCAGTCCGGTGCTACTTGATCCTTTGCTTCTTGCTTCTCGAAAATCGTGGTGGTTGGAAGGCGTGTATAAATGTATTGGTGCGCTTGTGCGCTTTC
CTGTTCCTGTAGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGGATATCTTCTAGCGGGCCCATAACCCGCTTGAA
CGTTTTACGGTCCAACGTGAGGCACTTGACCTTGCCCTTCGCTGTCACTGTTGCCTGGCGTGGTCGTGTTGTGAGTAGAGCAATTTCACCGAAGTATGCA
CCTGAAGTGAGATCGCCCATTTCCACCGGTGGCTCAGCGGGTGAGAGCTGCTTCGTACACACTGCCGTGCCTTCCTCAATGATGTAAAACAGGTTGCCGT
CGTCACCCTGGGTGATGATGACTTCGCCGTCACTAAACGTCTCCGTCTTGAGAGCATCCGCCACTGTGAGGCGCTCGAACTCGCTTAGCGACTCGAGCAG
CGGTACACGTTCAATGAAGCCCTTGTGTGCCTCACGTTTCTTCAAAGTCGTCTCCATGATAATGAACTTAAATGTCTGTCGATCCAATGCCCAGGCCTTC
GAGTGCTGTACTGCCTTGACAGTTGCAGCACGCGGAGCGTTGTACATGAGCGCCAACTCACCGAATGACATAGCCTCTGTGCACTATATTGGAAGCAAAA
AAAAATCGTCAGAATGAAAATAACCAACAAAAAAAGCCACGACCAGTTTTCCTCGTGTAACGCACCGTTTGAACAAGCTCGTCGTCCTTGTAGACCTCGC
AGACGCCACTCTCGAGGATATAAAAGTTGTCGCCATCGTCTCCCTGCTTGATAATGGTGTCGCCGGGCTCGAACTCCTTGGGGAACATGGCGTCCAGCAC
AATGTCGTGCTGCTTCTCGTCCAGTGCCTTGAACAAAATATTCTCAACCACCATGCGGCTGATGCACTCCCTTTCCTCAGCAGACTTGGGATGCACCACA
CGCTCAAATTGCCGTGCACTGCCGCGTCACATGCAAAAGAAGAACATGAGCACGTTAGCAGACAGGACGGGAAACTCCACATATAGCATCAATTGTCATT
CACGAACCTCAGGGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGTGGCGGTGCGCTGGCAGCGATCTCCCCCACG
GCGTCGCTTCCTTCGTCCTCGTCCTCGCTCTCACTCTCGTCCGAGTGATCTAGCAGCAGCAAAACGGAGAGTGTTTTATCGTTAGATCTCTCGTCTCTCT
CCCAAATAAAAAGTCAAAGAGTCGCGTACATTGCACATGAGGTGATGCGGCGGGGTTGTCATCCTTGGCGCCGGGCTTGCGGCGCGGTGTGGCCTCCTCC
GGGTAGTTCGTCTGCAGGTACTGGATAATGTGCAGGATGGGGTTCTCTGGCTTGGCCAGTAGCAGCGACTCGACGAGGTTGATGAACAGCGTGTTGATGC
CCTTCTTGTGCAGGTAGTCCTGCAGTTCCTGTTGCACGCCCTCTGCGTCCGCCATGGTGTGCTCGGTGGCTCTCTGCTGTCTGTCTGAGTAGTGAGTGCG
AGCGAATCTGCGGCTGGAGAACTAAACTGAGCGCCTGGCGTCACGGGCCTTCGCTCCAAAATGGAAGAAAC