Description :
From Genome Similarity Track
Location :
Scaffold_4:20552- 24501
Transcript NameFunction/comments
g3534.t1hypothetical protein

Sequence
3949 bases(100 bases per row)
CATCACCTGCTTGCATTGCTTGGAAACGAGCTCTCGCACGTGCACCTTGGTTGAATTCATAGAGTAATGCACCACAGCTCAGTTGTGTCACTGGTAACCA
CTCGGGTTCATCACAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGTCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAACT
TCGTACTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCATTCACGTTCAACTCCATATTCGGGC
GTTTTGGAAATAGAGCCCGGGGCTTCAAACGACTGATGTGCACCCAAGGGTTGACACGATATCCGGTGTCTTCGATCTTGAGCTTCACCCTGAAGTCATC
ATGCACTTCCTCAATTCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGAATGTACAACCACACCAGGTCACCC
ACTTCGAACCCGGACTTCAGTCTGTCGGAAAGTTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCAC
ATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAGGCGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAA
CGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGA
TCGTCCCAATCACTCTGATCCGCTTCCGAAATGTACGCACGGATGCTCCTGACTACCGTCTGGACGGATCGCTCCTGTTGGCCATTTGCCTGGGGACGAT
ATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAGCGGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGCAACATCGAACT
TGCTCCAAACCTTCGGAAGACGCACTCTTCATAAGCTTCCGCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGCA
TCTTGGAACAAAAGCAAAAAGGTGTTCCCACGCTCGGACTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGT
TTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATCCCAGGCCA
ATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAGTGATGCCTTGATGGCCGCCCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGAC
TTCGGGACGACCAGCCTTGGCTCATCCACAAAGTCCCTCGGGCGGTCTCGGGTAGATCGTGCAAGTCGGTACAGTACATCGCGAGTGTCGAGCGCAAACA
AGTCAGCAACTTTGGCAATCTTTCGGAGGCGTCTGGGTGAGAATCTGTCAACTTCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTC
CTGATGAACTTTGATGCGACGCCATCTTTCCGCTTGGAATTCCAGAGGTCCCATTGGTGGTCCATCCAGAGATTCGGTGGTTTGAAGGCCTGACCTCGTC
ATGACTGCCATCACTCTGGCGGCTGCCGACAACGGGGCAGAATCAGCATCAGGAAGCACCGTTCCTACCTGAGCGTCCCTCGCATCCGAGCTTCCGGGTC
CCACTGGACTGGAACTGTCATCGCCATCTGGAGTGTCAGTCTTCGTGACCTTTTCGGGTATTTTAGACACTACTTCCAGGTGTCGGAGCTCATGTTCGTC
TTGGACTTCCCATGACTCACCCAGTAGCAACGTCTTGGAAGTCAAGTAATCGGCGGCTTGATTGTACTCCCTTTTGAGGTGTGCCAGCCTTACCGTCCGG
AACTTGGCCTTCAGAACATTAGCCTCCGCGAGATGCTTTTGCAGGTGAGGCTGATTGCAATTGATTAACCCTTGCACTTGCTCAATAACAATTCGGGAGT
CACCGACCACGAATAGATCTTCGACATGATGTTCGAAAGCCATCGTCATACCTTTCAGAAGTCCGTAGTACTCAGCGTCATTCACAGTAACATCTTTTAG
AATATAACCATGTGCTTCTAGAACGGTCCAACCGGGCACCTTCCAAAGGATGCACCCGCAGCTTCCTTGACGAGTCGATGTCTTGGCAGATCCATCGAAG
CTAAGGACGATTCCATCGTAATCTGCATCCAACATCTCAACACTCACCACAGGCGGCTGCCGGATCTCACCTTTCGCTGGAATCAATGATTCAGCAACTT
GGTCTAAGTGTTCACGCGGAGTGATCCCAGCGCCCATGATAGCAGCCAGACCATCCTCGTCCCGTTGAACCTTCCGGATTTCCATGTTCCACCCGGATAA
CGCGAGTCCCCATGGGACGCATCTTCCGTCGGCGGATTTGGAAGTGATGACCCACTTCAGAACGGAGTATCTCGTATAGACGATCAGTGGACAATGTTCA
ACAATCGTCCGGAACACCTGAAGCACCCTCATGATAGCGATCACCTCTTTCTCGGCGACATGATACCTCACTTCGGAGTCGTTCAGGACGCGGCCGGTAT
ACCTGACCGGGTGTATCTTCCCATCATATTCCTGCCCGAGGACTGCACATGCGGCCCACTGATTGGCATGCGGGATGATGACGAACGGTCGGGAGCGATC
CGGATGGCGTAGCAACGGAGTTGAGACAATCTTCCGCTTCAGGATTCCAAAGGCCTCCTTAGCTCTTGACAGATTACGTCCTGAGCGCACTTGGTCATCC
GAGAGTTCATACAGCACCGCAGCTACCACTGGAAAGTCCTCAATAAACTTGTGATAATAATTGAGACTTCCGAGGAACGATTGTACCCCTTTCAGTGTGC
TTGGGAACGGCAAGTCCTGAACGCCTTTCGCAATCTTAGGTGTCGCTCGGATGCCTTCAGCACTGATCTCGTGCGACAGATACGGGATCGACTTCTTTCC
GAACTCACTTTTAGGGAGGCTCACGGAAATATTCCAGTACCTCAACCTGAAAAGGAGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCA
TGTGCAATGTCGTCGATATAGGAACTACGTCCCAAGACAGGGCCCATCTGAGATGGCGCAGGGATATTCCTTTTGAACACCGTCATGTACTCAGTCAGCG
TCGGGACTTCAGGATTAGTGTCCACATCCAGAAGATTGGCTGCCGGAGGGGGCAACTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGCTTCTTCCTC
TGGAGGCAGCCGGACGAATCCCCACAGGCAGTTATTGATTACTGCCTGATACACTAAAGGCGCGTTTTTGAGTCCAAACGGCATTCGCACCCATTGGAAG
TGTCCAAACGGACACACAAAAGCCGAAATCAACTTGGCACGCTCTGACATTCGAACCGCCCAGAATCCACTAGCCATATCCAAGCTCATGAACCACATTG
CGTTCTCAAATCCTAACAGTAAGTCGTCAATCAGTGGTAACGGGTAGTTCGAAAGTTCGATAAAACCATTGACGATCCGGTAATCAATACACATCCGGAT
GTCTACACCGTTTTTCTTCAGGACAATCACGATCGGAGAGGACCATGGTGATTCGGAAGGTTCGATCAATCCAGTTTCCAAGAGTTTCTTGAGTAACTCA
TAGACCTTGATAGCCAAATGAGGTGCGATGGATCGGGCGCGTTGTGCGACCGGCTTGGCCGTCCCAACGTCCAAATCACAAATCACTCCTCTTGCCGGAG
CAGGAGCGGCATTTCCATCACCCAGAAAAATAGAGCGGTGGTACTTCAG