Description :
From Genome Similarity Track
Location :
contig_30:205519- 226705
Transcript NameFunction/comments
g6553.t1hypothetical protein
g6554.t1hypothetical protein
g6555.t1hypothetical protein
g6556.t1hypothetical protein
g6557.t1hypothetical protein
g6558.t1hypothetical protein

Sequence
21186 bases(100 bases per row)
CATAAGGCGGGCCGGGGCGCATGAAGTGCCCATGTGCGGCGCGACCATCCAAATGGCCTCCCGTCAGAAAAGGGAGCTTGAAGGCTTCGTGCACAGGCGG
TGTAAGGCGGTGTTTTCCTCCCAGAACAAGAGCGCGGCCACGGGGATGGATGCCCGCGCGCGTGTTAATCCGAGTGGTGGCACCGCGAGCGGCGAGCGTT
GTGCGGCCGACCTCGAGCGAGCCCGCTCAGCGAGCCAGGCGCCACTACGGTACCGTACGAAAGCTCGGTCCGCCCCGCGCATGGTCGGAAGCCCTTCTCT
TGCATAGCGGAGACCGTCCTGTTCGTCACCACGATCGCCTTCCACACCGGAAGGACGTGCTTGGAGCTGTTGCCGGGCAGCACGACGAAGCGAGCGATTG
AGCGCCATTGCCACGGCCGCAGCGCGTGCTCTCTACGTGTATTGCCGCCGCCGTTGACGGTCCAGCGGATCCCCGCTCGGATCCTGCGAGCCCCACCCAC
CACAGCGTCGACGAGCTGCTGATGTCATCGGTCCTGCTTTGCAATCGTGCTGCCTGTCCGGAAAACCAACTGCGGCGCAGAGGCCCGACGCGCGCTATGC
GATACGCTAAGAGCCGGGCCGCAACGATCAAGTTGGGAACGGCAGCAGCCAGATGCTGTTGCCGCCGGAGCTCACCACGCCTTGATGACTCGGAGTGCGG
GTCGAAGGCATGGGCGCCGTAGCTCACGATACTCACGCGGCAGCAGGCTACTTGCCAACTTGCAGCGGTGCAACGGCCAGCGACCACGGTCACCTCGCCG
CCGCGGACTTGTAGGGCCATCGCGTTGGCTCTTCTTTCCGCTACATTGTACATGGAGGCAAGCCTGCATTCCTGAAGTGTAAGGAAGGGCTTTTCCTGCC
ACGCGCGACCTGCCTGCACGCTGCCACGCCGCCGCCGTCGTGTATGAAATGTGCCGCGCGCGATCTGGCCATAACACCTTTGCATTGACGAATGCCGTTT
TATCGGCCGTGGCGAGAAGGGCCACGAGGACACCGCCCCGAAATGGACACCAAAGGCAACACCGCGCCAATGCTAGCAACAATGCTGCCACCGCGCTGCT
CATGCAATACAGCACACAGTGTTGAAGCGTGGCGGTGAGGGCGTCCAAACGCGCTCGACGGACGGCGGCGCACATCGTGCTGGAGCGCCGCTGTCTGTTA
TCACGGCACGGCGTTCACATCGGCCAGGAGCAGATCCAGTCGCGCTGTAATTGCCTTTGCGCGCGACCAGGCGCTTGCCTTTGCGGCCTCGTTAAAAGCC
CTTTCGCGTGCACGTGCCGGGCCGGTACGTAGATATTTGAATTCCGCCAATGGGCGGCGCGCTGCTCCGCGGGAACGCGCAGGATTGGTTCATCCTGCCT
GCTCTCTTATCACGGCATCCGACCAGAAAAAGAGCCTGAGATGGGCATGGGACACGCGAAGGGATCGGGGTGCAGAAACCAGTGCGACAGTTGTGCCTTT
GCGACCGCATCGCCCGCCCGTGATTAGACGGCCGACGGCGCGGATGGCGGTGAAGGCGCCGCCAATGTGGTGCCGGCGCAGATGAAGGCGTTGTTGTGGG
CTTGCCTGTCTCTGAGTCCGGCCGGACCCGTCACATCAACTCGACGCGTGCCCCGAAAAAACGGGATGCAAGTTGGGGCAAACACAACTGGACGCGATTC
AATCTTTTTGAACCGAAGATGCTCCCCTAACCACGCGGCTGCCCCTTCTTTCCCGCCGCGCATGACCGGGCGTCTTGTCCATCCGCAAAAGGGGGAGCCC
CGAGTGAGTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTACTCGCTTCGTCTTCGTCTTCGCGGTGCCCGTCTCCGCCAAGGGCCA
AGTATTTTTTCTGCCGGAGCCGACGCAGTTAGTTTTATGGCCTCCACGTCCTCGTCCTCGGCGTCCCAGTCCACCAGCAGCAGCTCCAGCACCCGAGCCA
TGCAGCCGCAAGATCCCAACCCCGCCGCGCTCGACGCCTCGGCCGCACAAGCCTTCAACTACGACCCGTCCTACCAGCAGTACGCGCAGGAGCGCGCGCT
GCACGACCAGGCCGTGCACAACTCCATGGCCGCTGTGAGCGGCTCCGCCAAGCCCGCAGGCGCGTCCAAGGAGTCCGTCGTCAAGACCAATGACCCCTCG
TCCGCCAGCGCGTCCCCCACCAGCGTGACCAAGGGGGCCCCCGGCTCGACCTCGTCCACGACCAGCGCGTCCTCCTCCACGGCCGCCAAGACCGCGGGCG
CCCCGGCCCGCAACGAGTCGCTCAAGTCCAACCGCCTCTGCACGATGCCCGGCTGCACCAAGCGCGTGCGCTCCAAGGGCTTGTGCAAGGCGCACGGAGG
CGGCCGTCGCTGCATGGTCGACGGCTGTGAGCGCAGCAGTCAGGGGCAGGGCCTTTGCATCCGCCACGGCGGCGGCAAGCGCTGCACGCAGCCAGGCTGC
ACCAAGGCTTCCCAGTCCAACGGCCTCTGCAAGGCCCACGGTGGTGGCTTGCGCTGCCAGAGCCCCGGCTGTACGAAGAGCAGCCAGGGAGGAGGCTTCT
GCCGCGCCCATGGCGGCGGTCAACGTTGCGAGAAGGAAGGATGCAACAAAGGCGCCCAGCGCGGCGGCTTCTGCGCTGGTCACGGCGGCAGTCGCTTCTG
CCAGCACCCGGACTGCACCAAAAACGACCGTGGGGGAGGTTTCTGCGCGGACACGGCGGCGGCAAGCGCTGCGACCACCCGGGCTGCAACAAGCCCGCCC
GCAAGAAAGGCAAATGCTCGTACCACGCCAATGCTGCCAAGGGCAAGCTGCCCAAGGACCAACTCGCCACGGCTGGAGTGGCCGCAGCTTCGTTGCCGCA
GCACATGATGGATATGCGACAGATTACCACGCCGACGTTCGCGATGGGTGTCAAGGATTTGCGTGGGGACCAAATTGACGCGCAACGCGCCAGCTACGTG
CAGCAGCAGCGAGCGGAGATGGACATGCGCTACAAGAGCTACGAGGCGCAAACCAACGCCGGCCAGTACCTGCAGATCCACGCCGACCAGCGATCGTATG
AGCCCATCAGTTTGCAGGCTGGTGGCGCCCAGCGCCACTACATGCCGGTGGACAACGGATCTCTGCCTCCGGTGTCTGGCAGCATGTACAAGCCATCAGA
CCGTCAGGCGTACGCCTCGCGTGCCCCAGAGCAGATGAAGAACCCGTACTCGCAGCACTGGGCCGCCAAGCCAGAGATCCCACAGCACCACCCGGATGGA
CGGGTTGACTATTTCGATGTGAACAAGGAGCAGCAGCAACAGCAGCCTCCTGGACACCACCTGCCTTACTCGGCTCAGTCCGCACAGTACCACCACCACC
TGAGCGCCGCTGACTCGGCTGCCGCTGCTGCAGCCTATGGCCAGCAACCGCCTGCTCAGCGTGCATACTATAGCCAGCAGCCCCCGCAAGCTCCCGCATC
CGGTGACCAGCCAGCGCCCCAGCAACAGCAGCAGCCCAACATGATGTACTATTCGGCGAACGGGTACCCGCAGCACCAGATGCACAGCATGCAGCAACAG
CAGCAGCAGCAACAGCAGATGCAGATGTTATAAGTCCGGCAATGCCACCGTGCAGTCGCTGAACGGGTCTGCTCCTTGCACGTCGCGCAATATGAGACGA
AGCTGACGAATTGAGTGCAAGACGGCTGTGAGGTGACTGCACGCTGTAATAGAGATAGAATCAACCCGCCATGGATCGGAGCTCCTCAAACTCGAGGAAG
CGGCAGAAGTGTTTCGTGCCGTCGGATAGGGAACGTAGCCTTCCTCCCTACCAGTTTTGACCAAGCTAAAGGAAGGATCGAGCGAGAAAAAGCATTTATC
CACTTCAACACGTCCGTATTCAAATGTTATCTGTAACTGCGGGGCGAGCCCATGTACAGCGGCACCGCCGACATCTTGGTCTCTTTTGAGTGCAGAAGCC
TGTCAGAAACATCACCTCGCCCTTCTCTTGCTTGTACAAGCCCGGACTCTTTCGGTGTGTGTCCGCCAGAGATCGAGCAGCGCAGGCCAAAGGCTGCACG
CAAGAAGCTTCACATGGTATGTACAGGACGGAGTTCACATTTGCTTCGGTTTGCTAGCTCTAATAGTCTGGTCCTACACTGAATTGGGACGGCGTGGAGG
CCCGTCGAGCCAGCACCGCAGCCTCGTCCTCGTCGTCTTCGTTGTTGCCGAGCTCCCCAGCGTCGTGCTGCAGTCTGGCTGCAAAGCTGGTGGCCCGTCG
TCGGGGCGCTACGGCCGCGGGGCGTCTTCTACTTGGACTATCTATTGACACGGCGGCGGTGGGGCCCCGCACGTCCTCGAGCTTGGCGTTGCGGGCCGCG
CCTCCCCGTCTCGACTGCAGCTTGGCCTGCAGGTACGTGCCGATGGCCGACGTTGGCAGATGCAGCGGCCCGGGGGACGACACGCGGGGTGAGCCAGCCT
CCTGGCTGTCGTCCAGAGCCACGCGGAAGCTACCCTTGCCCGCATAATAGTGGCGATAGCACTCGATGAGTTCGTGCTCCATGCCCGCGTACGTCTCCAG
TAGCTGCGCGGCTGAGGCCTCATTGCCCGGCTCGTAGACGTGCAGCAGACGCTCCAGCTCCGCCTTGTAGGTGGCCGCGTCTTGCTGGTTGTCGCGCCGG
GGACTGCTCTCGAGAGGGCTCTGCGGACGCATGAAAAAGAAGCTGCGGCGGATCGGGCGAAAAACGTAAAATGGCTCTTGGATGCCTCTTTGTGCGGTGC
ACAGTTCTATATTTTGATTTTTCCATCGACTTTAGCTTCAACCAGCTCCCAATGGGGAGCCATCGGCCACATGGGCTTCAGTCGCAGTTGGAGCTGCTCG
ACTGGCAGTCTTTTTCAATGAGTGGCATCCGCTCGATTTGCTACAAGATCAGCCTTGATGCTCACGACTGCAGGGCCTGGGCGTCGCGCAGCAGTGTCTG
GAAGCACTGGATCAGAGTGGCGATGCCTGTTCGCAGCCCTTCGTCCCGCTTGGGAGACGCGTGCTGGGTCGCGTGGGCAAAGTCGATGAGGCGGATGTCA
GCTGCGTAGGGCTCCGACCCGGTGTCGCTGCCTTTGACAGACGCCCCGCCGTCGTACAGGAAGAGGAAGGAACTGGCGATGAACTCCGTTCCTTGCTGCT
CATCGAACCACGTCTTGAACTGGTCGAGGCGACGCAGAAACTGAAAGGCAGACAGCAGTCGATACCAGATACGAAGAGCGTCAGTTGCGAGTCTATCACA
AGAAACAGCACTGCAGTAGCCTTACAGCTTCCAGCAGTTGAATAGTCTTGGGCGTATCTTCTGGCGGGAAGTAGTTGCGGAAGGCCGGTGCAAGCTCGTC
CACAGAGGTGATGCTGCGACCAAAGTGCTTGTCGAACTCGACATACCGCCGCTGCTTCGGGTCAAACATCTTGATCCCTTGAATACGGAAGCCCGCCGTC
TCCTGCAGCGGGAACTTGGACTTTTCGTACGCGATCTTCTCGGCCGTCGCGTCCTCTTCGTAGGACCGGGTGCCCATCTTGACGTCCATAATGCTCGGCC
ACTGCCTCCCCCACGTCAAGTCTTCCAGAGCTAAATACTCTGCACCCAGCCACGATACCCAACAGCAAATTAGTACACTTCTAGAGCCCAAAGTTCCTCA
ACTTGATCAACTTTTGCCCACGTCCAGGGTGCAGTCCATTGATAGGCGTCTCCTCCTCGCCGTCCTGCACTTCAGGGACCTCCACGGTGCCATAATAACC
GGGTAGAAACTGCATGAGACTTGCAAACTCAGGCGAATCCTTCTCCGACACGAACACGCGCTCGTAGAAGCCGTGCTCGCGCTGTCCACGCTGTTTACTC
TGGAAAGGCTTCAAGATGCGGCCGTTGTGAGCCTTCAGGCCTGCCACAGAGAGCGCAAAGGCGACGATATTTACACCATTAGAATACCAGAAAAATATTC
ATTAACTAAGACTATCGCTGGGTACTTTACTCGTGTTGGACGTGGCGTGGCCGCCCACTTGGTGTGCCATCTCCACGAAGCATTTGGTGTCCGCCATGCT
GTGCCTTCAAATTGTGATATAGTCCGTAAAGATCCCAGCTCTGATTTGCAGCACCCTATTTTGTGACGAGAATGGCGCGCGTGCTGGTGCTGGGCGGCAC
AAGCTACGTGGCACAGTTCTTGCTGCAGAGGCTACTGCAGAGCGAGTCGCTCCGTGTAGCTGACGGAGATGTATTGGGTGACATATCTGCAGTGGCATGC
ACAATGCGCAGTCAGCCATTCTCGCCACTCCCCAATGGGTTTGTGACGGAATCGGATTCTGCAGCGCAGTCGACGCGGACTGTGCGCGTGTACTGGCAGG
TGGACATCCTGGACTTGGGAGCACTGGGAAATTGCATCAAAGAGTTCCACCCGACCGTCGTGATCAATTGCACAGGTAAACTAGTACTGGAGCTTGGTGA
ATGATATTTTAAATGCTGATCTTTGCTGGCTGTGTGTCGCGCAGCGATTTCATCGCCTGCACTTTGCCAGAAGGACTCGGAGAAGGCACACGCTATCAAC
GAGGTGCTTTGAGCTGGCTTTTTTTTACGGACGGCGCCTCTCTTGACATTACTTGTGTTGATAGCCTCGGGAGCTTGTTACTTTACTGGACCACCTTCCG
TGGCGAATTCGATTTGTGCACTTGTCAACGGACTTTGTTTACGATGGAAGGCAACCGTGGGGTGAAGGCTACGACGAAGACGCTGCAGTGTTGTCATCGG
AGTTGTCAGTGTACGGTGCTGACAAACTTCGGTTCGACCAACACCTGATGGAGCAGAGCTCGGCAAACTTGCAAGTGTTGATTCTTCGTATCGCAAATGT
GGTTGGCCCGGCAGCTCCATTGTTCCCCGATAGAAGCGCACCAAAGTTCATGGAATGGCTGCATCACCAGCTCTTTCAGTCCGGAACTGCTACTGTGCCA
CTGAAGTTGTGGCGTGACGAGTTTCGCTCTTACCTTTATATTCAGGACTTTGTCGCGATCCTCTTCAAGATGCTGTCGGCTCAGGCTGAGACGCCCGCTA
CTCTTGTCAACGTCGGTGCGTTCGCTCTATTCGATGAACTTTCGCTTTACAAGACTTGCTAACGTTCGTGCAGGTGGTGTGGAGGCACTTTCACGTGTGG
AACTCGCGCACAAGTATCTTGCTGCTTCACAAGGTACAATTCGAAAGCGGTGAATGCAGTAAAGAGAGAGATCGTGCCGACCGCGCGAGCACAAGTCGAC
TTGGGGTACCCTTCTCCGCTCAACACGAAGCTCAGCACAGCACGGCTCGCGCACCAACTGCCAACCTTCGCCAGGACATCGACGGATCAATTCCTGGACG
AGATTAGCCACAGCTTTCTTGCTTGAAAAGGGAACGCTGCAATGTTATATGCTCAAGCTAACGATGGGGTAAAGAAAAAGATGACCAGAACGATGCCATC
AAGTAGTCGCCATACCTACATACGAAAACGCGCCCCACTCGCGCAGGTGATAGAGTCATCCAGTTACTGGATCTCCATCACGTTTCCCATGCTCTGCCGC
CCTTTCTCGAAAGCTTGCACGATTGGATCCTCATTGTTGCCCTTGCTGCCAGACGTTGACGTGTAGACGAAGTCCGCGTCACATAGGGCAATCGCGTTAC
ACGCTTGGCTGGGGCTCTTTCCCTTGCGCATGAGCGACACCAGCTCATCGAACTTGGAGGAAAGCACGTCGCAACGCGCACGGGGTGGTAGAACCGTGCA
TATGGTTTCGAGTGTCATCTTCGCTTCACGCAAAGCCTTCTCATTGTCCTTGGCGCGCTCCAAAAGATCGGCAGTGTACTCGCAGAATAAGCAGCCCACC
GACATCGACTTCTCCGCAGGCACCTCCTCCACCGCTGCAGGACCACACGCTGCGATTCGCGTGCAGATGGTCTCCACATCTTCGTTATTTTTCAGTGAAT
CAACGATCATGTCCTGGTGCTTCATCAGTAGCTCGCACTATTAACGGACAAACACAATTGTTGTCAGGCGCATTGCAACGCAACATATGAAAGGGGCGAC
TTCTTACCTCGCTGGAATCTGGGATCAAGCGACACACCGAGTTGATTTCGCGTTCGAATGTTGCCAAGCTGTTAGGACGAGTAATCAAGGACGCAAGCAG
CAACGTATTCTGCTGACACGATGCACACCTCGAGGGCAAGAAGTCCGAGCCCTTAAAGTCAAGCAGGCCCGACACCAGCGAACTGGTACCTTGAGTTGCC
GTGCAAAACTTAAGTGTCTGGCAAATTTCTTGCGGCTCCTTTCCAGCTTGTAAATCGGTCACTGCCTCGTCGAACATCTTAAGGTCATCGTGGCACTGTC
ATTTAAGCAAACAATATATCAGTATCATCTCACATAGTTGTACAGAAGACTTCGCTGTTCTGCATACTTACCGTGTCGTCGGCAGGGAGAAGTTCGCAAA
CGATGCCTGCAGCCTCTCGCATTTCCTTCACTTGCTCCGGCTTCTGGTCAAGTGCGTACTTGAGCACAGTGACAATGCCACTGCAGTAGGCACATGTGTT
GCTTTCCTCGTCGTTGTCTCGAACGGCGATCATGTCAACTGAAGGCATTGCAAGCTTGGCCATAGCAGGGTTGGTGTCCACCGTGCAATACTTCAGGTCG
TGGCAAATAGCCTTGGGCTGTTCGCCCTTCTGCAGAGAATCGACCACAGCATCGAACTGCTTTACAAAGGAGTGGCACTGTAAACACATACATAGAAAAA
TTAGCAACCTCCTCGATGCATGTCAGTTGAGGCAAGTATCGTACCTGGTTGTCGCTCGGAAGCATTCCGCAAACAACGTCAGCGATTTGGCGAATCTGCG
CGATCTTACTCGGGTCTTGAGCCACGGCCACCTCAATGATGGACGCCACTTGCGTGCAGAAAAAACATCCATCAACCGACACTTCCATCGATTCCTTCAT
CATTTGGACCAACACCGGATCGTAAGCCGACAAGCTGCTGGGTGAAGAGGCCGGGGAAGGCAACGTGTTGTTTGCCGGGCAATAGTTCATCGATACACAA
ATAGCGTGCGGGTGCGTCCCGTTCTTCAGCGAATCCAGCACAAAATCAAGCTTTGCAATGTACTTGTGGCATCCACACTCCTCGCCCATCAGCGCACAAG
CAGTGTCCGCCAACTGCTTGATTTGACCGATCTTTGTGGCATCTTGTTCATAAGCAGCTTGCACAAGAGTAGTCGCATAGTCACAGAAGAAACACGTCTT
CGTGTCACCCTCAACAGCATCAGGGCGACTCGCGACAATCAGAGCCGACACAGTGTCAGCAAAGGAATACTCGTCAGCGACCACGTCCACTTGCTTCTTA
CAGAGCCCGATGGTCTTGCAAATCTCGTGCGGGCGTTTTCCCTCCTTCTCGAGTTCCACGATCTTGTCAAAGTTCTTATCCACTTCATCGCACTTACAGT
CAGGCTTTGCCAGCTTGCACACGTTCGTCAAAATGGTCTTGACGATCGGCAGCTTTCCCGGGTCAGTCTGATTGACGTGGTGAATGGCAATACCAACATG
AATGCAGAAGGAACACCCATGGTTGTGTGGCGGGTGTTCTTCTGAGCTCAAGACCACCGCATTTCTTCACTGTCAGCGAGAGCTGGCTGTTTATCCATCG
CCGCAGTGCAAAACTTCAACTCCGTGCAAATTGCCTTGGAGCTCATACCCTTGGTGATCGAATCAATGACAAAGTCGAACTCCTTCACGTACACGTGGCA
CGGGTTGTCTGCACCGAGCATATCACAGATCATGTCTGCGTACGCGCGGATTTGGCTGATATCGGTGCCATACTGTTGAAGGGCAATTTTAGCGACAGTG
GTGGCGAATTGGCAGTATGTGCACTCTGTGGCGTTTCCAGGGGGCCACTGTGAAGCTACCACCACACCCTTCATCTCGTCCGCAATCGAAGGCGCACCTT
CCTCCCAGCCTCGTGTCTTGTTGCAAACCCCAAGTGACTTGCAGATCTCATGCGGATGCTTGCCCTGTTTTTCCAGTTCCACAATCTTGTCGAAGTTCTT
GTCCACAACATCACACTTGCAGGTTGAAGGCACCAGTTGACACACGTTGGTTAGAATGGTCTTCACGATCGGCAACTTTTCAGGAGACGTGTGGTTGACA
TGGTGAATCACCATCGCCACCCGTGAGCAGAAGAAACAACTGCCATGGGGGTGCGGGCGGGGATGAGGAGGGTGCGGTGGGTGCTCGTCATGTGGGATGA
CTCCCATCTTATCACGCTTGCCATGACCGTGGTGGCCGTGGCGGCCTCCAGGCCCCTCCATGCCAACATGCGCATGATGTCCATGTCGGCCATTTCGCAT
CATTCCGACACGAGGGCTTTCGTCCAGAAGTGGAGGGCCATCCATGCGTTCAGCAGAGCAGTATTTCAGCGCCTTGCAAATTTCGCGAGGGTGCACTCCC
TTCTTTAAGGAGTCAACGACCGTGTCCAACTGGTTGACATACTCGTGGCACGGGCTATCATCTCCCAGCATACCGCAGATCATGTCTGCGTACTCGCGAA
TTTGATCAATCTGGTCAGGTTGCTCTTGCATAATAACCTCCACAACCGTTGTAGCTGCGTCGCAGTACACACACGTTTTATCATCTCCATGCACCCGATC
CGATGGCGGCATATCATGCATGTTTTTTTGGGCAGAAATCGGCTGCTTGACAAATCTCGCGCGGGTGCTGGTCTTGCTGCACCAGCTCGATAATGTAGTC
AAAGTTAGCCTCCACTTCCTGACACTTGGCGTCCTCGGAAGCTAACTGGCACACGCTTCCAAGGACTGACTTCAGCATCGGGAGTTGTTCAGGAAATAGG
CTGTTCACCTGGTAGATTACTCCGGCCACACGAGAACAAAAGAAGCACGACTGGTCCTTCTCCAGGAATTCGGGGGTGGTTAGAGCGCCATCTCCGATTG
TTTCGAGCTCTTCCGGATACGCTGGAACATCGGAGATCTGACTGTCACTGCCACTGTCGGGCGAGCACATGGCGATCCGAGTGCACACCACGAGCGGGTC
CGTGCCGTGCTTGAGCCAGTCCACGATAGCGTCGAAATTCTTCAGGAACGTGTGGCACATGGAGTCTGTCGACATGGCGTCGCACAGGTCTCCAATGATA
ACTCGGACCTGCTGCACCTGCTGCACTTCCTGGCTCAGCGCCTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGCACGACAAGTTGTCGGCTCCTT
CCAAGTCTTCGACTGTGGCCATGATGTCACACACCTCATCGTCCGTCTTGCCCTCCTGCAAGAACTCCTTCACCACTTCTTCCGAGCTCAACACACGGTT
GCACTGTAAACAAAACAACATACCAACATCAATTTCCCCTCCCACTTCATCAATGAAACTGCATCCCGCACCTCTTCCACCAGCTCGGAACGCTCGAGAT
CATCGCACGAAGCCGCCCCCCACAGCTGCAGCGACACCACGTCTAAGGCCGAGCGAAAGTACTTCGCGAGCGTCTCCGTCTGCTGCTGCAGCTCGTCCTG
CTCGTGGATCTTCTCCAGCGCCTTCAAGCACGCCGTCTTGCGTGGATCCTCCTCCTCCTCTTCAATGATCACGATGACGTCAGCCTCCTGGGGTTCCCCG
AGGCTGAAGAATTGCTGCAGCATCTCGCTGGAGCGCTGGAAATGCTCGTTCAGCACCGCCATGAGGCCGGCGGTTTCTTCCTCCTCCTGGTCGTGATGGC
AGGGCATTTCGGCGTCCTGGCGGTGGCCCAGGCCTGGGCGCCCGCCGTGGTCGGCACTTGCGACGGCCGCAGCGGCCGCCAGACTCGGCAGCAGCGCGTA
CACGGGGCGCATGGTTTCTCGCTTCCCTCGACTTGTTCTTCAAGCTGGGTCGAATCCTGTTTGAAGCGGGGCGTGTGACTCCAGAGGAAGAGGACGGATG
GCATGGCGAGGTAGGAGTCCGCCTTCCACCATCAGTCGAATCAATAGTGAGATGGAGAGAAGATGGTTTTGTGTGTGCCACATTGGTACCGCCGTTGAAT
AGTAAAAGGCTCAGGATCAGGTGGAAGGAGGAGAGGTCGACAATAAGGTACTTGTCGCAGAAGGAATGCTGGTTGAAGTGGCCAGCCAATCGGCTGCATT
TGCACCAAAGCGGATCTCAACGTAACTTGTACCATTTCAGTCATTTCCTCTATACTTTTCTATCGGCGCTGTTCCTGAGGCTGAGAACTAACTCACGTTC
AACATCGCAGTGAGCTGCAAGCTGCCGCTTTGCGTCGAGCGAGGCACCCACAGCAACAGCGAACCACCTCCCGTTCCGGGAAGACGTAGGATACCCGGAC
GCCATCGATCCAGATACAGCGTCTTACCTCCCAGTTCCGCTACACTCGACGTCCATACCACAGTCCCACCTGCCGAGACGGCCACCTTGTCGAACTTGTT
GCCACCAGAGTGGATATTCACAGTCACATCCTCAGTGTCAACACTTTGAAACGTGATGGTGACAGTGCCATCGCCGACCTTGGTCCAGTTGCCAGAACTG
TTGGCGAAGGCGTCCCCGACCATCCTGAGACCTAGTGCGTCGTTTTGCACTTCCATCGTCGATTTCGCCGGTGAATTTGGTCGGTCCACAAATGGTCTGA
AAGTACTCGGAAATCACACTGTCGATATTTGTTAGATCCCAAACAGCGTAGAAAGTAAGCGCCTTGTCAGCGATCTTGTAGGCGTATTTCTCTGCAGTGA
GAAGCGTTCCGTTGGGGCTGGTGCCTGAGCGGATTAGGTCGTCCATGATGCCCCAAAACTCTTGCGCAGCGTGTCTCGCGTTGCATAAGCAGCATCCTCG
TCCGACTGCTCAATCAGCTCTTCCATGCAGTTGTTGGTGACGATGGGGATCTCGGTAAGCACGAGGGTTGACTGGCTCATGGCCACACGAATATCGGCCT
CGGAAATCTCCGGGTCTTTCCTACGCAGGTCTGCCACATTCATCCAGGTGCGGTCCAGCAGGCGCTTCATGTTATACCCGCAGGTGGAGTTAGACTCCAA
TGCTGACTGCAGTGAAGTGATGTCGGACTCGTCTAACGAATCCAGCGGCTTGTCTAACGCGATTCTCTTCATGAATATTGTAAACGCTGCCCAACTGGCA
ACGATCGCACCCTTGTCGCTCACAATTTCTTTCACGAAAAGCTCAATCGTGTTGGTCACTCTGTCGGTTGTCTTGATACTCTCCGACACGTGCATATCCA
GGCATGTGCAAATGGTGATAGGTAAATCGAAAACCACGTTGTCGGTCTGGTACAGCATCGTTTCCAGATACTTGTTCGTGGTGTGCGGGCTGGATACTTT
AATGGTGCGGATGAATTTTGTCAACTGCTTCACCAAGTTCATTATCTCCTTGCCGCACTTGAAGGCGATGCGCACACCCTTCGCCATCAGCTTGAACTCG
CCGTACAAACCGAACGTAGCAAGGGAGAGTGCCGATTGTGCAATTACGGATACCTTGGACACGATTTCATGCACGCAGTCGTCGTTTTGCCGTATGCATT
CCAAACCGCATCTTACCGGGTACGCCAGCGGACATTCAGCCCAGCAAGCGTCATGGTGGCTATCAAACTCGAGCGGGCAGGTTTGTGCAATATGAGTCTC
TCGGTAGCACGCTGTGTCAGAGCCACCTCCGAGTGCAGGACCCACCCAATTGGTATACGCTGACTCAATCGTAGAGATGGTTGCCACACTCGTGGAGCCG
GAGGCCATCGCGGTGTCTGATTCTTCGTCGTCGGCACTGTCTAGATCCCCCTCGTCGTCGTCTTTTAGTAGTTCATTGTCACCACGGTCGCCGCCCAAAG
ACCTGTTGTCGTCACTGTCGGAAGCGCCGTCGTGGCTCGGAGTCGCAGTCAAAGAGCCGGTAGTAGTAGGTGTGAAACTTGCAGCATCCACGAAGGTGTA
TGTCTGCGCAGTAGAAGTCGCGATGCCCGCACTCAGCAGTGCAACGACTTGGATCAGCTTGAGCATCTTGATCGATGCCATTTTTTTCACGAGCACAGCC
CGTAGCGATTTCTGCGCGAGTGCAAATGGTAACGTGTCTGTAAAATGAAAAATAAGCGTACGGTGTGCATACCAAAGGCTATCCTAGACGTCCGTCTTGG
TCACAAAAGTTTGCTGCTGCGAGCCATTTGTTCGTAAGACGACGCAAGCTACCGTCTAGCAAAGCTGCTAGGAAAGACCGCGAAGGCGCAATGAGATTGT
GGCCACCAGTCTGGTGAAATACCACGACTTCGATGTTATCATCGATTCCAGCGCAAAGCCTAACCTGCACTATAATTCCCTCAGAGCAGTTGCTGCAGGT
AGGCGATCTTCGCTTGGTCATGCGACTAGCATTCACTATAATAACACCCGAGTGGCAGTACTAGCAAATGATTAGAATGGTGGTTTGCAAAAGATAAATT
GTGATGTATGCCGACGGCATTGCAAAGCTCACAAGTTGCGATTACTTGCCGCCCGATTTTTTGTTGTTCGTTCTCAAACCACAAAAAAGAAGCGAACTTC
AGGATTGGCGATGCAGATGGGCTGTGAGAACGTAAGTATTAATAGTGCTCGCTGCAGTGCTCACAGTCTCCCACAAAATAGATTGCATTCGTCCCGTTCG
TCTCAAGCAGAACTGGCAGTATGAAATGTAACTGCACGTCTAAATACTTGTCACTGCGCAATTCATTCACTACATCGTTTTGCCGTTTTCTAATCGCTAC
AAGTCCGCGGGAAGTGATTAGAAAATGATGATTACAGCTTCTGCTCGGAACCACCAACGTTGCCTACGCAAGTGAGACGCGGCTATGGAGCCCGTCTCAT
GCATTTCGTCGTGTCATTGCCAACGCCAGCGCCAGCGCAGCGATGGCGTTGCAAAGTAAGCCCGCAAGGGTGTGCAAGCAACATGAACGACGCGAACGAC
ACCTCTACACAGTCATGTAATAAGCTCAACCAGGGACTGGATGAAGGGTGTTGTATCCGAGTAGACAATCCTGGTGGAGCGCTAAGAGGTTTGTTTTGTA
GTCCGCAGAGAAAGTATGACGACCACACGAGTGAAACAACTCCATGAAGTGCATGTGCTTTCTGTTGATGAACTGGTGGCGCCAAAAAAGTCACAAAGAA
ATAATACCTAAGCGACTGTAATAAAACTAATGTGGACCAAATGCCACAAAAAATAGATGACATACAGGTACATTTGCGATGGCTAGCAAGCAATGTCATT
TCTTGTTGATAACTTATTATATTATTTGGATCATAGTTTCATACTTCTACTGACTCACTACACTTAACAGAAATGAAGGTCATACTAACTCACATTGAGC
ATCGCATGGAGCTGCAGGTTCCCGCCCTGGGTTGACCTCGGAACCCACAGCAATAACGAACCGCCCCCTGTTCCGGGAAGTCCTAGAAAGCCCGGACGCC
ACCGATCAAGATACAGTGTCTTGCCTCCCAAAGCCGTCATGTTCGAGGTCCACGTCACAGTCTGACCCGCAGCGACTGCCACCTTGTCGAACTTGTTGCC
ACCCGACTTAATGTTCACAGTCACGTCCTCCGTGTCAGTGCTCTGGAAGTTGATCGTGACAGTGCCGTCACCGATCTTGGTCCAATTTCCAGCACTGTTG
TTGAAAGCAGTATCCACTGCCTTCAAGCCCAAGGCTTCTTCAGCAGTCCCGTCATCAATATCGCCAATGAATTCGGTGGGGCCACAAATGGTCTGGAAAA
ACTCGGAAAGCACACCGCCAATGTTTTTCCTCTCCCAAACAGCGTAAAACGTTGCAACCTTGTCAGCGATTTTGTACATGTACTCCCCAGCCGTCAGAAG
CGTGCCGTTGTTGCTCGTTCCAGAACTGATCAAGTCGTCCATAATACCCCCAATGCCCTTGCGCAGTGTATCTCGGGTCTTGTAAGCTGTAGCCTCGTCC
GATTCTGCAATCAACTCTTCCATGCAGTTGTTGGTCATGGTAGGATTTCGTACAGCGCGAGGTTTGACTGGCTTATCGCGACGCGGATATCGTCCTCGGA
AATCGCTGGGTTCTGCCGGCGCATTTCAGCCACAGTCATCCACGTGCGGTCCAGCAACCGCTTCATGTCGTATCCACATGTCGAGTTGGATTTCAGTGCG
GTCTCCAAAGAAGTAATGTCCGATTCATTTAATGAAGAAATTGAAGCACCCAGCGTGATGTTCTTCATGAAGCCCGTGAATGCACTCCAACTGGAAACAA
TGACGGCGCCGTTGGCGATGATTTCCTTCAAAGCGAGCTCGGCTGTGTTGAGAATTCTGTCAACAGTCTTGATCTGCTCATCCACTTTGATGCCTAAACA
GGCAGCGATAGTCACTGGGACGTCAAAGACCACATTGTCGGTCTGGTACAACATTGTCAGCAGTTGGTCTTTGGTGGTTTGAGGGTTAGATACCTTGACA
GTGCGGACGTACTTGGAAATCGACTTGACCATCCCCATCATCTCTTTGCCACACTTGAATGCAATTTGGATACCCTTTGCCATTACCTTGAACTCGCCAT
ATACGCCGTACGTAGCGACAGATAGAGCTGCCTGGGCTACGGCCGACACCTTGCTCACGACTTCGAGCGCGCAGTCGTCATTCTGCCGGATGCATTCGAG
ACCGCACTCAACAGGGTAGGTAAAAGGACACTGGGCCCAGCAAGTTCCAAGCTTTCCGTCGAAACCGATCGGACATGTCTTCGCAATGTGGGCCTCTCGA
TAACACGCCGTGTCAGCTGCGGTGCCGAGAGCTGATCCTATCCAGTTTTTGTACGTGGAATCGATCGTACTGGTGGCGTTGAGACCGTTGCCAATGGTGA
ATCCTGCGTTCGCCGAAGACGACGTCCCAGACCCGGTTGTCGCCACAGAACCATCCACTGCTAGTGCGGAGTCGCTTTCATCGTCACTGTCGGAAGAGCT
GCCATCGTGGTGTATGTCGTCCTCACTGTCTACGGACTCGTCGTCGCTGTCCTCGTCGCCCGTTGACCGGAAGGTGACGGTTGCGGTAGTATTTACTGTG
TAGTTGGCGGCGGTCACCGTTGCAGCTGGGACGGATGCTGCGCTTGCGTTGAATGTGAATGATTGAGCTGAAACATTAAAAATTGCCACGAAGACGAGGA
CAAGCACCACGAATAACTTTGCCATAAGTCTCGCAAGGCGCGCAAAATTAAGAATGGCGTTCGACCGCCTAAACTCGAGCGTATCTGTATTACGTTCTTT
TATCGTGCTGGCATGCGGTGACCGTCTCAACACTTGTAGATTCGCGACCGTCGTGAGCCGCGCGACGCCCGGACATTATTAATCCAACCTTCAGACTTGT
ATCGAATCTAGTATTCCGGCGCAACGACGAATCTTGTAGGAAAAACGAGGACAACAGATCACCACGGGGCAATCGACGGGCGCTCTTCCAGTCGTTGGCG
GCCTCTGGTAGAAATCATTGGCATTGGCTAACACATTCGGAGTACATTTCATGGCCAGCTGGTTGACACAAGTGGCACAAAATTGGAGCGAAGAGTGAGA
GGGTCCGCCTTCGTGATTCAGTTGGCTGAGGCGAATGCTTTCTTAGAATCAATCGACGGGACCAGAACCTCCACGTGGGGCTACCAAAAGGATTGGCAGG
CCATAAATGGGCTCGCATATTGAAGGCCAAGCGATTTGCATTGACCCCAAAGATTCGGGTCGAAGTGCCAAACTGTCCGTGTCGATCACGTCAATACATG
AAGCAGGAGCGAGACGCTTTCGCTTGTGTGAGTGAACTTTACTACTCGTGCTGCGGCCCAAAATGTGCAGCCTTCACCAGGCGCTGTGGGACACTCGTTT
ACGATCGAGGCCCCGTTGAAGCACTGCAGTACACGTGCATGTGCTGCTGCAACCTCTCGCGTGCCTGGCTGAGGCGGGTGATAGCCGCGAGAGTCTCGCC
GAGACCGTCTCAAACTCGTCAATCGTTCGTACAATCGACCGCCAAACTCGAATCTACTCAGATACGCATTATCAGTTTAACAGCGCTAATACCTGAACTG
CTGGCAGCACGGCAAGTTCTGGACCGCCGACTTGTCTCCCTAAACAGCATGAGGTGATCCCGTTGGCATGGTCCCGTTGCCTCTCTACGGTACAGTACAA
CCACCAATATCCCGCCCGATCTGACGCAGGGAACACGACACCGCTGCAGTCCAGCTACAGGGTAACAACTCCCATCCGGGCCTTCCCTCCACGATTGTGG
TTGCCCAAACAATTTATCGTAGTCGGATTGCGAGGGAAATCACCCAAACATTTGCTTGGACGCGGCAGCTTTTCTCCTCAGCGTTTGCAAAAAATCCCGA
CGCGACTGCGCATCGCTGTAGTGCCTAGACACTCCTTCGTCGTGGTGACCTCCACCTTCAACACTGTTTTTTGCCTGATGCACTCCATCTTCCATTGCTC
TAATTTCGCCGCCTTTATCTTCAAACTCGCCCGACTGTTCATACGAAAGCGCATCCATTTCGTGGGCGAGTAGAAATTCACGGATCTTGTCGATCTGTCC
TCGCTCCGGAGCAAAGTTTGAGATCTCCACTTGGCCCGAAAGGTTGGCGATATCAAAAGCACGCTGAAACTTTGTTGACGAGAAAGGTAATGGTAGTGGC
GACTCCACACCAGCACTACATCCACCGGCAGCAGCAACCGGATCTACTACCGTGATCACTGGCACCAGAGCGGTTTTGTGCGGGAAGTAGTTGCAATTTT
CCGGGATGTCAACCTGCACCCGTGTAACTGCAGCTTGGGTCCCAGGGCGGTGCAAATCCAACTCCCGCGCCAGATACCCAGAGATTCGCGCTCCTACCGC
ACAGTGTTTCAACGCGACATCCAAAAATTTGTGCCACCGTGAGCTACGAACAGCAAATTAGCAATCGTTAGCGCTCAACTTTCCAAAGTTATCTAGACCT
TTAGTTGATACAGCAACTCACCGCTGTCGACTGCTTCCCCCACCATTTCCATGCAGATCTCCAGATTCCAGTTCGGGCAGTGGGTAGTCGTCGAAAAAGA
CACAGTCGAATTGGTCCAGCGTTGGTAACTGCTGCTGCCACGTACCCGCGACTATTTCCACTCCATTGCGACTAAATGCAAACTGCTGAGCGCGGTGTAG
TGTCTCCCGGTCGCATTCGATGATCGTGTGGCTTTTGGGTCGGAATGTCTGGATGCGAGAGGCCGAATATGCCAAGCCGAAGCCGATTTCCAGCACACGA
TCCGTTGGCTGGATGACGAGCGCGTCCACGCACAGTTCCATGTACTGCATCTCCCACCGCATCATGACCTGCTGCCCCCGAGAGCTCCAGAGGATCTCCT
GCCCGAGCTCATCGAGCCCCTTGACGTTGCCTTGCGTTGTCATCGAATCTGCTAAATATTTGTGATTTATATCGACCAAAAAATAGTCACCTATATTTAT
TAGCCACATTACTTTTATTGACAGACATTATTACAATCCTAAAACTTCCTCTCAGCTAACATTAAGCATCACGTTGAGCTGCAACATGCCGCCTTGGGTA
GACCGAGGGACCCAGAGCAATAACGAGCCGCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCG
CAGTCACGTTCGACGTCCACGTCACGGTCTCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGT
ATCGACGCTCTTGAACGTGATGGTTACAGTGCCGTCTCCAACCCTCGTCCACATGCCATCACTGTTGTTGAAGGCATCTTGAACGATCGACATCCCCAAT
GCTTTTTTTGCGGTACCGTCGTCAATTTCACCGATGAGCTTCGTGGGGCCACAGATGGGCTGAAAGTACTCTGAAATCGTGCTAGCAACGCCCCACAAAT
CCCAAATAGCGTAAAATGACGCTGCCTTGTCCGCAACCTTGAAAGCATAATCCTCGGCCTTCATAAATGTGCCATTGTTGCTCGTTCCGGAACTGATGAG
ATCGTCCACGATGCCTCCAAATGTCTTGCGTAGCGTGTCACGCGTGGCGTAGGCCGCAGCTTCATCCGATTCGGCAAGCAGCTCGTTCATGCAGTTATTT
GTCACGACGGGGATATCATTGAGCATTAGGTTCGATTGACTCATGGCCACACGAATATCGTCTTCAGAGATGAACGGGTCTTGCCTGCGTAGATCTGCCA
CGGTCATCCACGTGCGGTCTAGCAGTCGCTTCATGTCGTATCCGCACGTAGAATTCGATCCCATTGCGGACTTCAGTGATGTAATCTCTGTCTCGTTCAA
CGAGCCGATCGATTCGTCGAGTGTGATATTCTTCATGAAAGCTGCGAACGCGTCCCAACTGGAAACGATGGCATCGTCATTAGCCAACACTTCTTTCAAG
GTGTACTCTGCAGTGGTGAGAACTCGGTCCGCAAACTTGACGCTATCGTCGACCTTGATGTCGAGGCACGAGGCGATTGTCACTGGCAAGTCGATGATGA
TATTGTCTGACTGATACAGTACGGCGAGTAGTTTGCCTTGTGAAGTCTGCGGGTCGGAAACCTTGGTCGAGCGGACGTACTTGGCCAACGATTTGATTAA
GCCCAGCATATTCCTGGCGCACTTGACGGCAACTTGAAGGCCCTTCGCCAGCAATTTGAAGTCCCCGTACAAGCCGAGTGTGGCAAAGGACAGTGCCGAT
TGCACCACTACCGATACCTTGGTCACGACTGCGAGCGCACAGTCGTCGTTCTGCCGGATGCATTCAAGGCCGCACTCAAGGGGGTACGAGTACGGGCACT
GAGCCCAACACGTTCCCAGCTTTCCGCCGAAACCGAGCGGACAGGCTTTGGCGATATGGGCTTCGCGATAGCATGCCGTCGAAGACGAGGTGTCCAGCGC
TGTACCAACCCAGTTCACATATGTAGACTCGATCGTGCTTGTAGCATTGGCAGCACTACCAATAGTGAATGCCGCATATCCTGAAGATAGCGAGGAACTC
ATTTGCGACCGAGACGCACTCACTGCCTGAGACGAGCTGTCGTCGCTGTCTGAAAAATCACCGTCGGTGCTGTCGGAAGAATCGTC