Description :
From Genome Similarity Track
Location :
contig_30:205513- 226699
Transcript NameFunction/comments
g6258.t1hypothetical protein
g6259.t1hypothetical protein
g6260.t1OWZ05452.1 hypothetical protein PHMEG_00022461 [Phytophthora megakarya
g6261.t1hypothetical protein

Sequence
21186 bases(100 bases per row)
CATAAGGCGGGCCGGGGCGCATGAAGTGCCCATGTGCGGCGCGACCATCCAAATGGCCTCCCGTCAGAAAAGGGAGCTTGAAGGCTTCGTGCACAGGCGG
TGTAAGGCGGTGTTTTCCTCCCAGAACAAGAGCGCGGCCACGGGGATGGATGCCCGCGCGCGTGTTAATCCGAGTGGTGGCACCGCGAGCGGCGAGCGTT
GTGCGGCCGACCTCGAGCGAGCCCGCTCAGCGAGCCAGGCGCCACTACGGTACCGTACGAAAGCTCGGTCCGCCCCGCGCATGGTCGGAAGCCCTTCTCT
TGCATAGCGGAGACCGTCCTGTTCGTCACCACGATCGCCTTCCACACCGGAAGGACGTGCTTGGAGCTGTTGCCGGGCAGCACGACGAAGCGAGCGATTG
AGCGCCATTGCCACGGCCGCAGCGCGTGCTCTCTACGTGTATTGCCGCCGCCGTTGACGGTCCAGCGGATCCCCGCTCGGATCCTGCGAGCCCCACCCAC
CACAGCGTCGACGAGCTGCTGATGTCATCGGTCCTGCTTTGCAATCGTGCTGCCTGTCCGGAAAACCAACTGCGGCGCAGAGGCCCGACGCGCGCTATGC
GATACGCTAAGAGCCGGGCCGCAACGATCAAGTTGGGAACGGCAGCAGCCAGATGCTGTTGCCGCCGGAGCTCACCACGCCTTGATGACTCGGAGTGCGG
GTCGAAGGCATGGGCGCCGTAGCTCACGATACTCACGCGGCAGCAGGCTACTTGCCAACTTGCAGCGGTGCAACGGCCAGCGACCACGGTCACCTCGCCG
CCGCGGACTTGTAGGGCCATCGCGTTGGCTCTTCTTTCCGCTACATTGTACATGGAGGCAAGCCTGCATTCCTGAAGTGTAAGGAAGGGCTTTTCCTGCC
ACGCGCGACCTGCCTGCACGCTGCCACGCCTCCGCCGTCGTGTATGAAATGTGCCGCGCGCGATCTGGCCATAACACCTTTGCATTGACGAATGCCGTTT
TATCGGCCGTGGCGAGAAGGGCCACGAGGACACCGCCCCGAAATGGACACCAAAGGCAACACCGCGCCAATGCTAGCAACAATGCTGCCACCGCGCTGCT
CATGCAATACAGCACACAGTGTTGAAGCGTGGCGGTGAGGGCGTCCAAACGCGCTCGACGGACGGCGGCGCACATCGTGCTGGAGCGCCGCTGTCTGTTA
TCACGGCACGGCGTTCACATCGGCCAGGAGCAGATCCAGTCGCGCTGTAATTGCCTTTGCGCGCGACCAGGCGCTTGCCTTTGCGGCCTCGTTAAAAGCC
CTTTCGCGTGCACGTGCCGGGCCGGTACGTAGATATTTGAATTCCGCCAATGGGCGGCGCGCTGCTCCGCGGGAACGCGCAGGATTGGTTCATCCTGCCT
GCTCTCTTATCACGGCATCCGACCAGAAAAAGAGCCTGAGATGGGCATGGGACACGCGAAGGGATCGGGGTGCAGAAACCAGTGCGACAGTTGTGCCTTT
GCGACCGCATCGCCCGCCCGTGATTAGACGGCCGACGGCGCGGATGGCGGTGAAGGCGCCGCCAATGTGGTGCCGGCGCAGATGAAGGCGTTGTTGTGGG
CTTGCCTGTCTCTGAGTCCGGCCGGACCCGTCACATCAACTCGACGCGTGCCCCGAAAAAACGGGATGCAAGTTGGGGCAAACACAACTGGACGCGATTC
AATCTTTTTGAACCGAAGATGCTCCCCTAACCACGCGGCTGCCCCTTCTTTCCCGCCGCGCATGACCGGGCGTCTTGTCCATCCGCAAAAGGGGGAGCCC
CGAGTGAGTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTACTCGCTTCGTCTTCGTCTTCGCGGTGCCCGTCTCCGCCAAGGGCCA
AGTATTTTTTCTGCCGGAGCCGACGCAGTTAGTTTTATGGCCTCCACGTCCTCGTCCTCGGCGTCCCAGTCCACCAGCAGCAGCTCCAGCACCCGAGCCA
TGCAGCCGCAAGATCCCAACCCCGCCGCGCTCGACGCCTCGGCCGCACAAGCCTTCAACTACGACCCGTCCTACCAGCAGTACGCGCAGGAGCGCGCGCT
GCACGACCAGGCCGTGCACAACTCCATGGCCGCTGTGAGCGGCTCCGCCAAGCCCGCAGGCGCGTCCAAGGAGTCCGTCGTCAAGACCAATGACCCCTCG
TCCGCCAGCGCGTCCCCCACCAGCGTGACCAAGGGGGCCCCCGGCTCGACCTCGTCCACGACCAGCGCGTCCTCCTCCACGGCCGCCAAGACCGCGGGCG
CCCCGGCCCGCAACGAGTCGCTCAAGTCCAACCGCCTCTGCACGATGCCCGGCTGCACCAAGCGCGTGCGCTCCAAGGGCTTGTGCAAGGCCCACGGAGG
CGGCCGTCGCTGCATGGTCGACGGCTGTGAGCGCAGCAGTCAGGGGCAGGGCCTTTGCATCCGCCACGGCGGCGGCAAGCGCTGCACGCAGCCAGGCTGC
ACCAAGGCTTCCCAGTCCAACGGCCTCTGCAAGGCCCACGGCGGCGGCTTACGCTGTCAGAGCCCCGGCTGTACGAAGAGCAGCCAGGGAGGAGGCTTCT
GCCGCGCCCATGGCGGCGGTCAACGTTGCGAGAAGGAAGGATGCAACAAAGGCGCCCAGCGCGGCGGCTTCTGCGCTGGTCACGGCGGCAGTCGCTTCTG
CCAGCACCCGGACTGCACCAAAAACGACCGTGGGGGAGGTTTCTGCGCGGACACGGCGGCGGCAAGCGCTGCGACCACCCGGGCTGCAACAAGCCCGCCC
GCAAGAAAGGCAAATGCTCGTACCACGCCAATGCTGCCAAGGGCAAGCTGCCCAAGGACCAACTCGCCACGGCTGGAGTGGCCGCAGCTTCGTTGCCGCA
GCACATGATGGATATGCGACAGATTACCACGCCGACGTTCGCGATGGGTGTCAAGGATTTGCGTGGGGACCAAATTGACGCGCAGCGCGCCAGCTACGTG
CAGCAGCAGCGAGCGGAGATGGACATGCGCTACAAGAGCTACGAGGCGCAAACCAACGCCGGCCAGTACCTGCAGATCCACGCCGACCAGCGATCGTATG
AGCCCATCAGTTTGCAGGCTGGTGGCGCCCAGCGCCACTACATGCCGGTGGACAACGGATCTCTGCCTCCGGTGTCTGGCAGCATGTACAAGCCATCAGA
CCGTCAGGCGTACGCCTCGCGTGCCCCAGAGCAGATGAAGAACCCGTACTCGCAGCACTGGGCCGCCAAGCCAGAGATCCCACAGCACCACCCGGATGGA
CGGGTTGACTATTTCGATGTGAACAAGGAGCAGCAGCAACAGCAGCCGCCTGGACACCACCTGCCTTACTCGGCTCAGTCCGCACAGTACCACCACCACC
TGAGCGCCGCTGACTCGGCTGCCGCTGCTGCAGCCTATGGCCAGCAACCGCCTGCTCAGCGTGCATACTATAGCCAGCAGCCCCCGCAAGCTCCCGCATC
CGGTGACCAGCCAGCGCCCCAGCAACAGCAGCAGCCCAACATGATGTACTATTCGGCGAACGGGTACCCGCAGCACCAGATGCACAGCATGCAGCAACAG
CAGCAGCAGCAACAGCAGATGCAGATGTTATAAGTCCGGCAATGCCACCGTGCAGTCGCTGAACGGGTCTGCTCCTTGCACGTCGCGCAATATGAGACGA
AGCTGACGAATTGAGTGCAAGACGGCTGTGAGGTGACTGCACGCTGTAATAGAGATAGAATCAACCCGCCATGGATCGGAGCTCCTCGAACTCGAGGAAG
CGGCAGAAGTGTTTCGTGCCGTCGGATAGGGAACGTAGCCTTCCTCCCTACCAGTTTTGACCAAGCTAAAGGAAGGATCGAGCGAGAAAAAGCATTTATC
CACTTCAACACGTCCGTATTCAAATGTTATCTGTAACTGCGGGGCGAGCCCATGTACAGCGGCACCGCCGACATCTTGGTCTCTTTTGAGTGCAGAAGCC
TGTCAGAAACATCACCTCGCCCTTCTCTTGCTTGTACAAGCCCGGACTCTTTCGGTGTGTGTCCGCCAGAGATCGAGCAGCGCAGGCCAAAGGCTGCACG
CAAGAAGCTTCACATGGTATGTACAGGACGGAGTTCACATTTGCTTCGGTTTGCTAGCTCTAATAGTCTGGTCCTACACTGAATTGGGACGGCGTGGAGG
CCCGTCGAGCCAGCACCGCAGCCTCGTCCTCGTCGTCTTCGTTGTTGCCGAGCTCCCCAGCGTCGTGCTGCAGTCTGGCTGCAAAGCTGGTGGCCCGTCG
TCGGGGCGCTACGGCCGCGGGGCGTCTTCTACTTGGACTATCTATTGACACGGCGGCGGTGGGGCCCCGCACGTCCTCGAGCTTGGCGTTGCGGGCCGCG
CCTCCCCGTCTCGACTGCAGTTTGGCCTGCAGGTACGTGCCGATGGCCGACGTTGGCAGATGCAGCGGCCCGGGGGACGACACGCGGGGTGAGCCAGCCT
CCTGGCTGTCGTCCAGAGCCACGCGGAAGCTACCCTTGCCCGCATAATAGTGGCGATAGCACTCGATGAGTTCGTGCTCCATGCCCGCGTACGTCTCCAG
TAGCTGCGCGGCTGAGGCCTCATTGCCCGGCTCGTAGACGTGCAGCAGACGCTCCAGCTCCGCCTTGTAGGTGGCCGCGTCTTGCTGGTTGTCGCGCCGG
GGACTGCTCTCGAGAGGGCTCTGCGGACGCATGAAAAAGAAGCTGCGGCGGATCGGGCGAAAAACGTAAAATGGCTCTTGGATGCCTCTTTGTGCGGTGC
ACAGTTCTATATTTTGATTTTTCCATCGACTTTAGCTTCAACCAGCTCCCAATGGGGAGCCATCGGCCACATGGGCTTCAGTCGCAGTTGGAGCTGCTCG
ACTGGCAGTCTTTTTCAATGAGTGGCATCCGCTCGATTTGCTACAAGATCAGCCTTGATGCTCACGACTGCAGGGCCTGGGCGTCGCGCAGCAGTGTCTG
GAAGCACTGGATCAGAGTGGCGATGCCTGTTCGCAGCCCTTCGTCCCGCTTGGGAGACGCGTGCTGGGTCGCGTGGGCAAAGTCGATGAGGCGGATGTCA
GCTGCGTAGGGCTCCGACCCGGTGTCGCTGCCTTTGACAGACGCCCCGCCGTCGTACAGGAAGAGGAAGGAACTGGCGATGAACTCCGTTCCTTGCTGCT
CATCGAACCACGTCTTGAACTGGTCGAGGCGACGCAGAAACTGAAAGGCAGACAGCAGTCGATACCAGATACGAAGAGCGTCAGTTGCGAGTCTATCACA
AGAAACAGCACTGCAGTAGCCTTACAGCTTCCAGCAGTTGAATAGTCTTGGGCGTATCTTCTGGCGGGAAGTAGTTGCGGAAGGCCGGTGCAAGCTCGTC
CACAGAGGTGATGCTGCGACCAAAGTGCTTGTCGAACTCGACATACCGCCGCTGCTTCGGGTCAAACATCTTGATCCCTTGAATACGGAAGCCCGCCGTC
TCCTGCAGCGGGAACTTGGACTTTTCGTACGCGATCTTCTCGGCCGTCGCGTCCTCTTCGTAGGACCGGGTGCCCATCTTGACGTCCATAATGCTCGGCC
ACTGCCTCCCCCACGTCAAGTCTTCCAGAGCTAAATACTCTGCACCCAGCCACGATACCCAACAGCAAATTAGTACACTTCTAGAGCCCAAAGTTCCTCA
ACTTGATCAACTTTTGCCCACGTCCAGGGTGCAGTCCATTGATAGGCGTCTCCTCCTCGCCGTCCTGCACTTCAGGGACCTCCACGGTGCCATAATAACC
GGGTAGAAACTGCATGAGACTTGCAAACTCAGGCGAATCCTTCTCCGACACGAACACGCGCTCGTAGAAGCCGTGCTCGCGCTGTCCACGCTGTTTACTC
TGGAAAGGCTTCAAGATGCGGCCGTTGTGAGCCTTCAGGCCTGCCACAGAGAGCGCAAAGGCGACGATATTTACACCATTAGAATACCAGAAAAATATTC
ATTAACTAAGACTATCGCTGGGTACTTTACTCGTGTTGGACGTGGCGTGGCCGCCCACTTGGTGTGCCATCTCCACGAAGCATTTGGTGTCCGCCATGCT
GTGCCTTCAAATTGTGATATAGTCCGTAAAGATCCCAGCTCTGATTTGCAGCACCCTATTTTGTGACGAGAATGGCGCGCGTGCTGGTGCTGGGCGGCAC
AAGCTACGTGGCACAGTTCTTGCTGCAGAGGCTACTGCAGAGCGAGTCGCTCCGTGTAGCTGACGGAGATGTATTGGGTGACATATCTGCAGTGGCATGC
ACAATGCGCAGTCAGCCATTCTCGCCACTCCCCAATGGGTTTGTGACGGAATCGGATTCTGCAGCGCAGTCGACGCGGACTGTGCGCGTGTACTGGCAGG
TGGACATCCTGGACTTGGGAGCACTGGGAAATTGCATCAAAGAGTTCCACCCGACCGTCGTGATCAATTGCACAGGTAAACTAGTACTGGAGATTGGTGA
ATGATATTTTAAATGCTGATCTTTGCTGGCTGTGTGTCGCGCAGCGATTTCATCGCCTGCACTTTGCCAGAAGGACTCGGAGAAGGCACACGCTATCAAC
GAGGTGCTTTGAGCTGGCTTTTTTTTACGGACGGCGCCTCTCTTGACATTACTTGTGTTGATAGCCTCGGGAGCTTGTTACCTTACTGGACCACCTTCCG
TGGCGAATTCGATTCGTGCACTTGTCAACGGACTTTGTTTACGATGGAAGGCAACCGTGGGGTGAAGGCTACGACGAAGACGCTGCAGTGTTGTCATCGG
AGTTGTCAGTGTACGGTGCTGACAAACTTCGGTTCGACCAACACCTGATGGAGCAGAGCTCGGCAAACTTGCAAGTGTTGATTCTTCGTATCGCAAATGT
GGTTGGCTCGGCAGCTCCATTGTTCCCCGATAGAAGCGCACCAAAGTTCATGGAATGGCTGCATCACCAGCTCTTTCAGTCCGGAACTGCTACTGTGCCA
CTGAAGTTGTGGCGTGACGAGTTTCGCTCTTACCTTTATATTCAGGACTTTGTCGCGATCCTCTTCAAGATGCTGTCGGCTCAGGCTGAGACGCCCGCTA
CTCTTGTCAACGTCGGTGCGTTCGCTCTATTCGATGAACTTTCGCTTTACAAGACTTGCTAACGTTCGTGCAGGTGGTGTGGAGGCACTTTCACGTGTGG
AACTCGCGCACAAGTATCTTGCTGCTTCACAAGGTACAATTCGAAAGCGGTGAATGCAGTAAAGAGAGAGATCGTGCCGACCGCGCGAGCACAAGTCGAC
TTGGGGTACCCTTCTCCGCTCAACACGAAGCTCAGCACAGCACGGCTCGCGCACCTACTGCCAACCTTCGCCAGGACATCGACGGATCAATTCCTGGACG
AGATTAGCCACAGCTTTCTTGCTTGAAAAGGGAACGCTGCAATGTTATATGCTCAAGCTAACGATGGGGTAAAGAAAAAGATGACCAGAACGATGCCATC
AAGTAGTCGCCATACCTACATACGAAAACGCGCCCCACTCGCGTAGATGATAGAGTCATCCAGTTACTGGATCTCCATCACGTTTCCCATGCTCTGCCGC
CCTTTCTCGAAAGCTTGCACGATTGGATCCTCATTGTTGCCCTTGCTGCCAGACGTTGACGTGTAGACGAAGTCCGCGTCACATAGGGCAATCGCGTTAC
ACGCTTGGCTGGGGCTCTTTCCCTTGCGCATGAGCGACACCAGCTCATCGAACTTGGAGGAAAGCACGTCGCAACGCGCACGGGGTGGTAGAACCGTGCA
TATGGTTTCGAGTGTCATCTTCGCTTCACGCAAAGCCTTCTCATTGTCCTTGGCGCGCTCCAAAAGATCGGCAGTGTACTCGCAGAATAAGCAGCCCACC
GACATCGACTTCTCCGCAGGCACCTCCTCCGCCGCTGCAGGACCACACGCTGCGATTCGCGTGCAGATGGTCTCCACATCTTCGTTATTTTTCAGTGAAT
CAACGATCATGTCCTGGTGCTTCATCAGTAGCTCGCACTATTAACGGACAAACACAATTGTTGTCAGGCGCATTGCAACGCAACATATGAAAGGGGCGAC
TTCTTACCTCGCTGGAATCTGGGATCAAGCGACACACCGAGTTGATTTCGCGTTCGAATGTTGCCAAGCTGTTAGGACGAGTAATCAAGGACGCAAGCAG
CAACGTATTCTGCTGACACGATGCACACCTCGAGGGCAAGAAGTCCGAGCCCTTAAAGTCAAGCAGGCCCGACACCAGCGAACTGGTACCTTGAGTTGCC
GTGCAAAACTTAAGTGTCTGGCAAATTTCTTGCGGCTCCTTTCCAGCTTGTAAATCGGTCACTGCCTCGTCGAACATCTTAAGGTCATCGTGGCACTGTC
ATTTAAGCAAACAATATATCAGTATCATCTCACATAGTTGTACAGAAGACTTCGCTGTTCTGCATACTTACCGTGTCGTCGGCAGGGAGTAGTTCGCAAA
CGATGCCTGCAGCCTCTCGCATTTCCTTCACTTGCTCCGGCTTCTGGTCAAGTGCGTACTTGAGCACAGTGACAATGCCACTGCAGTAGGCACATGTGTT
GCTTTCCTCGTCGTTGTCTCGAACGGCGATCATGTCAACTGAAGGCATTGCAAGCTTGGCCATAGCAGGGTTGGTGTCCACCGTGCAATACTTCAGGTCG
TGGCAAATAGCCTTGGGCTGTTCGCCCTTCTGCAGAGAATCGACCACAGCATCGAACTGCTTTACAAAGGAGTGGCACTGTAAACACATACATAGAAAAA
TTAGCAACCTCCTCGATGCATGTCAGTTGAGGCAAGTATCGTACCTGGTTGTCGCTCGGAAGCATTCCGCAAACAACGTCAGCGATTTGGCGAATCTGCG
CGATCTTACTCGGGTCTTGAGCCACGGCCACCTCAATGATGGACGCCACTTGCGTGCAGAAAAAACATCCATCAACCGACACTTCCATCGATTCCTTCAT
CATTTGGACCAACACCGGATCGTAAGCCGACAAGCTGCTGGGTGAAGAGGCCGGGGAAGGCAACGTGTTGTTTGCCGGGCAATAGTTCATCGATACACAA
ATAGCGTGCGGGTGCGTCCCGTTCTTCAGCGAATCCAGCACAAAATCAAGCTTTGCAATGTACTTGTGGCATCCACACTCCTCGCCCATCAGCGCACAAG
CAGTGTCCGCCAACTGCTTGATTTGACCGATCTTTGTGGCATCTTGTTCATAAGCAGCTTGCACAAGAGTAGTCGCATAGTCACAGAAGAAACACGTCTT
CGTGTCACCCTCAACAGCATCAGGGCGACTCGCGACAATCAGAGCCGACACAGTGTCAGCAAAGGAATACTCGTCAGCGACCACGTCCACTTGCTTCTTA
CAGAGTCCGATGGTCTTGCAAATCTCGTGCGGGCGTTTTCCCTCCTTCTCGAGTTCCACGATCTTGTCAAAGTTCTTATCCACTTCATCGCACTTACAGT
CAGGCTTTGCCAGCTTGCACACGTTCGTCAAAATGGTCTTGACGATCGGCAGCTTTCCCGGGTCAGTCTGATTGACGTGGTGAATGGCAATACCAACATG
AATGCAGAAGGAACACCCATGGTTGTGTGGCGGGTGTTCTTCTGAGCTCAAGACCACCGCATTTCTTCACTGTCAGCGAGAGCTGGCTGTTTATCCATCG
CCGCAGTGCAAAACTTCAACTCCGTGCAAATTGCCTTGGAGCTCATACCCTTGGTGATCGAATCAATGACAAAGTCGAACTCCTTCACGTACACGTGGCA
CGGGTTGTCTGCACCGAGCATATCACAGATCATGTCTGCGTACGCGCGGATTTGGCTGATATCGGTACCATACTGTTGAAGGGCAATTTTAGCGACAGTG
GTGGCGAATTGGCAGTATGTGCACTCTGTGGCGTTTCCAGGGGGCCACTGTGAAGCTACCACCACACCCTTCATCTCGTCCGCAATCGAAGGCGCACCTT
CCTCCCAGCCTCGTGTCTTGTTGCAAACCCCAAGTGACTTGCAGATCTCATGCGGATGCTTGCCCTGTTTTTCCAGTTCCACAATCTTGTCGAAGTTCTT
GTCCACAACATCACACTTGCAGGTTGAAGGCACCAGTTGACACACGTTGGTTAGAATGGTCTTCACGATCGGCAACTTTTCAGGAGACGTGTGGTTGACA
TGGTGAATCACCATCGCCACCCGTGAGCAGAAGAAACAACTGCCATGGGGGTGCGGGCGGGGATGAGGAGGGTGCGGTGGGTGCTCGTCATGTGGGATGA
CTCCCATCTTATCACGCTTGCCATGACCGTGGTGGCCGTGGCGGCCTCCAGGCCCCTCCATGCCAACATGCGCATGATGTCCATGTCGGCCATTTCGCAT
CATTCCGACACGAGGGCTTTCGTCCAGAAGTGGAGGGCCATCCATGCGTTCAGCAGAGCAGTATTTCAGCGCCTTGCAAATTTCGCGAGGGTGCACTCCC
TTCTTTAAGGAGTCAACGACCGTGTCCAACTGGTTGACATACTCGTGGCACGGGCTATCATCTCCCAGCATACCGCAGATCATGTCTGCGTACTCGCGAA
TTTGATCAATCTGGTCAGGTTGCTCTTGCATAATAACCTCCACAACCGTTGTAGCTGCGTCGCAGTACACACACGTTTTATCATCTCCATGCACCCGATC
CGATGGCGGCATATCATGCATGTTTTTTTGGGCAGAAATCGGCTGCTTGACAAATCTCGCGCGGGTGCTGGTCTTGCTGCACTAGCTCGACAATGTAGTC
AAAGTTAGCCTCCACTTCCTGACACTTGGCGTCCTCGGAAGCTAATTGGCACACGCTTCCAAGGACTGACTTCAGCATCGGGAGTTGTTCAGGAAATAGG
CTGTTCACCTGGTAGATTACTCCGGCCACACGAGAGCAAAAGAAGCACGACTGGTCCTTCTCCAGGAATTCGGGGGTGGTTAGAGCGCCATCTCCGATTG
TTTCGAGCTCTTCCGGATACGCTGGAACATCGGAGATCTGACTGTCACTGCCACTGTCGGGCGAGCACATGGCGATCCGAGTGCACACCACGAGCGGGTC
CGTGCCGTGCTTGAGCCAGTCCACGATAGCGTCGAAATTCTTCAGGAACGTGTGGCACATGGAGTCTGTCGACATGGCGTCGCACAGGTCTCCAATGATA
ACTCGGACCTGCTGCACCTGCTGCACTTCCTGGCTCAGCGCCTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGCACGACAAGTTGTCGGCTCCTT
CCAAGTCTTCGACTGTGGCCATGATGTCACACACCTCATCGTCCGTCTTGCCCTCCTGCAAGAACTCCTTTACCACTTCTTCCGAGCTCAACACACGGTT
GCACTGTAAACAAAACAACATACCAACATCAATTTCCCCTCCCACTTCATCAATGAAACTGCATCCCGCACCTCTTCCACCAGCTCGGAACGCTCGAGAT
CATCGCACGAAGCCGCCCCCCACAGCTGCAGCGACACCACGTCTAAGGCCGAGCGAAAGTACTTCGCGAGCGTCTCCGTCTGCTGCTGCAGCTCGTCCTG
CTCGTGGATCTTCTCCAGCGCCTTCAAGCACGCCGTCTTGCGTGGATCCTCCTCCTCCGCTTCAATGATCACGATGACGTCAGCCTCCTGGGGTTCCCCG
AGGCTGAAGAATTGCTGCAGCATCTCGCTGGAGCGCTGGAAATGCTCGTTCAGCACCGCCATGAGGCCGGCGGTTTCTTCCTCCTCCTGGTCGTGATGGC
AGGGCATTTCGGCGTCCTGGCGGTGGCCCAGGCCTGGGCGCCCGCCGTGGTCGGCACTTGCGACGGCCGCAGCGGCCGCCAGACTCGGCAGCAGCGCGTA
CACGGGGCGCATGGTTTCTCGCTTCCCTCGACTTGTTCTTCAAGCTGGGTCGAATCCTGTTTGAAGCGGGGCGTGTGACTCCAGAGGAAGAGGACGGATG
GCATGGCGAGGTAGGAGTCCGCCTTCCACCACCAGTCGAATCAATAGTGAGATGGAGAGAAGATGGTTTTGTGTGTGCCACATTGGTACCGCCGTTGAAT
AGTAAAAGGCTCAGGATCAGGTGGAAGGAGGAGAGGTCGACAATAAGGTACTTGTCGCAGAAGGAATGCTGGTTGAAGTGGCCAGCCAATCGGCTGCATT
TGCACCAAAGCGGATTTCAACGTAACTTGTACCATTTCAGACATTTCCTCTATACTTTTCTATCGGCGCTGTTCCTGAGGCTGAGAACTAACTCACGTTC
AACATCGCAGTGAGCTGCAAGCTGCCGCTTTGCGTCGAGCGAGGCACCCACAGCAACAGCGAACCACCTCCCGTTCCGGGAAGACGTAGGATACCCGGAC
GCCATCGATCCAGATACAGCGTCTTACCTCCCAGTTCCGCTACACTCGACGTCCATACCACAGTTCCACCTGCCGAGACGGCCACCTTGTCGAACTTGTT
GCCACCAGAGTGGATATTCACAGTCACATCCTCAGTGTCAACACTTTGAAACGTGATGGTGACAGTGCCATCGCCGACCTTGGTCCAGTTGCCAGAACTG
TTGGCGAAGGCGTCCCCGACCATCCTGAGACCTAGTGCGTCGTTTTGCACTTCCATCGTCGATTTCGCCGGTGAATTTGGTCGGTCCACAAATGGTCTGA
AAGTACTCGGAAATCACACTGTCGATATTTGTTAGATCCCAAACAGCGTAGAAAGTAAGCGCCTTGTCAGCGATCTTGTAGGCATATTTCTCTGCAGTGA
GAAGCGTTCCGTTGGGGCTGGTGCCTGAGCGGATTAGGTCGTCCATGATGCCCCAAAACTCTTGCGCAGCGTGTCTCGCGTTGCATAAGCAGCATCCTCG
TCCGACTGCTCAATCAGCTCTTCCATGCAGTTGTTGGTGACGATGGGGATCTCGGTAAGCACGAGGGTTGACTGGCTCATGGCCACACGAATATCGGCCT
CGGAAATCTCCGGGTCTTTCCTACGCAGGTCTGCCACATTCATCCAGGTGCGGTCCAGCAGGCGCTTCATGTTATACCCGCAGGTGGAGTTAGACTCCAA
TGCTGACTGCAGTGAAGTGATGTCGGACTCGTCTAACGAATCCAGCGGCTTGTCTAACGCGATTCTCTTCATGAATATTGTAAACGCTGCCCAACTGGCA
ACGATCGCACCCTTGTCGCTCACAATTTCTTTCACGAAAAGCTCAATCGTGTTGGTCACTCTGTCGGTTGTCTTGATACTCTCCGACACGTGCATATCCA
GGCATGTGCAAATGGTGATAGGTAAATCGAAAACCACGTTGTCGGTCTGGTACAGCATCGTTTCCAGATACTTGTTCGTGGTGTGCGGGCTGGATACTTT
AATGGTGCGGATGAATTTTGTCAACTGCTTCACCAAGTTTATTATCTCCTTGCCGCACTTGAAGGCGATGCGCACACCCTTCGCCATCAGCTTGAACTCG
CCGTACAAACCGAACGTAGCAAGGGAGAGTGCCGATTGTGCAATTACGGATACCTTGGACACGATTTCATGCACGCAGTCGTCGTTTTGCCGTATGCATT
CCAAACCGCATCTTACCGGGTACGCCAGCGGACATTCAGCCCAGCAAGCGTCATGGTGGCTATCAAACTCGAGCGGGCAGGTTTGTGCAATATGAGTCTC
TCGGTAGCACGCTGTGTCAGAGCCACCTCCGAGTGCAGGACCCACCCAATTGGTAAACGCTGACTCAATCGTAGAGATGGTTGCTACACTCGTGGAGCCG
GAGGCCATCGCGGTGTCTGATTCTTCGTCGTCGGCACTGTCTAGATCCCCCTCGTCGTCGTCTTTTAGTAGTTCATTGTCACCACGGTCGCCGCCCAAAG
ACCTGTTGTCGTCACTGTCGGAAGCGCCGTCGTGGCTCGGAGTCGCAGTCAAAGAGCCGGTAGTAGTAGGTGTGAAACTTGCAGCATCCACGAAGGTGTA
TGTCTGCGCAGTAGAAGTCGCGATGCCCGCACTCAGCAGTGCAACGACTTGGATCAGCTTGAGCATCTTGATCGATGCCATTTTTTTCACGAGCACAGCC
CGTAGCGATTTCTGCGCGAGTGCAAATGGTAACGTGTCTGTAAAATGAAAAATAAGCGTACGGTGTGCATACCAAAGGCTATCCTAGACGTCCGTCTTGG
TCACAAAAGTTTGCTGCTGCGAGCCATTTGTTCGTAAGACGACGCAAGCTACCGTCTAGCAAAGCTGCTAGGAAAGACCGCGAAGGCGCAATGAGATTGT
GGCCACCAGTCTGGTGAAATACCACGACTTCGATGTTATCATCGATTCCAGCGCAAAGCCTAACCTGCACTATAATTCCCTCAGAGCAGTTGCTGCAGGT
AGGCGATCTTCGCTTGGTCATGCGACTAGCATTCACTATAATAACACCCGAGTGGCAGTACTAGCAAATGATTAGAATGGTGGTTTGCAAAAGATAAATT
GTGATGTATGCCGACGGCATTGCAAAGCTCACAAGTTGCGATTACTTGCCGCCCGATTTTTTGTTGTTCGTTCTCAAACCACAAAAAAGAAGCGAACTTC
AGGATTGGCGATGCAGATGGGCTGTGAGAACGTAAGTATTAATAGTGCTCGCTGCAGTGCTCACAGTCTCCCACAAAATAGATTGCATTCGTCCCGTTCG
TCTCAAGCAGAACTGGCAGTATGAAATGTAACTGCACGTCTAAATACTTGTCACTGCGCAATTCATTCACTACATCGTTTTGCCGTTTTCTAATCGCTAC
ACGTCCGCGGGAAGTGATTAGAAAATGATGATTACAGCTTCTGCTCGGAACCACCAACGTTGCCTACGCAAGTGAGACGCGGCTATGGAGCCCGTCTCAT
GCATTTCGTCGTGTCATTGCCAACGCCAGCGCCAGCGCAGCGATGGCGTTGCAAAGTAAGCCCGCAAGGGTGTGCAAGCAACATGAACGACGCGAACGAC
ACCTCTACACAGTCATGTAATAAGCTCAACCAGGGACTGGATGAAGGGTGTTGTATCCGAGTAGACAATCCTGGTGGAGCGCTAAGAGGTTTGTTTTGTA
GTCCGCAGAGAAAGTATGACGACCACACGAGTGAAACAACTCCATGGAATGCATGTGCTTTCTGTTAATGAACTGGTGGCGCCAAAAAAGTCACAAAGAA
ATAATACCTAAGCGACTATAATAAAACTAATGTGGACCAAATGCCACAAAAAATAGATGACATACAGGTACCTTTGCGATGGCTAGCAAGCAATGTCATT
TCTTGTTGATAACTTATTATATTATTTGGATCATAGTTTCATACTTCTACTGACTCACTACACTTAACAGAAATGAAGGTCATACTAACTCACATTGAGC
ATCGCATGGAGCTGCAGGTTCCCGCCCTGGGTTGACCTCGGAACCCACAGCAATAACGAACCGCCCCCTGTTCCGGGAAGTCCTAGAAAGCCCGGACGCC
ACCGATCAAGATACAGTGTCTTGCCTCCCAGAGCCGTCATGTTCGAGGTCCACGTCACAGTCTGACCCGCAGCGACTGCCACCTTGTCGAACTTGTTGCC
ACCCGACTTAATGTTCACAGTCACGTCCTCCGTGTCAGTGCTCTGGAAGTTGATCGTGACAGTGCCGTCACCGATCTTGGTCCAATTTCCAGCACTGTTG
TTGAAAGCAGTATCCACTGCCTTCAAGCCCAAGGCTTCTTCAGCAGTCCCGTCATCAATATCGCCAATGAATTCGGTGGGGCCACAAATGGTCTGGAAAA
ACTCGGAAAGCACACCGCCAATGTTTTTCCTCTCCCAAACAGCGTAAAACGTTGCAACCTTGTCAGCGATTTTGTACATGTACTCCCCAGCCGTCAGAAG
CGTGCCGTTGTTACTCGTTCCAGAACTGATCAAGTCGTCCATAATACCCCCAATGCCCTTGCGCAGTGTATCTCGGGTCTTGTAAGCTGTAGCCTCGTCC
GATTCTGCAATCAACTCTTCCATGCAGTTGTTGGTCATGGTAGGATTTCGTACAGCGCGAGGTTTGACTGGCTTATCGCGACGCGGATATCGTCCTCGGA
AATCGCTGGGTTCTGCCGGCGCATTTCAGCCACAGTCATCCACGTGCGGTCCAGCAACCGCTTCATGTCGTATCCACATGTCGAGTTGGATTTCAGTGCG
GTCTCCAAAGAAGTAATGTCCGATTCGTTTAATGAAGAAATTGAAGCACCCAGCGTGATGTTCTTCATGAAGCCCGTGAATGCACTCCAACTGGAAACAA
TGACGGCGCCATTGGCGATGATTTCCTTCAAAGCGAGCTCGGCTGTGTTGAGAATTCTGTCAACTGTCTTGATCTGCTCATCCACTTTGATGCCTAAACA
GGCAGCGATAGTCACTGGGACGTCAAAGACCACATTGTCGGTCTGGTACAACATTGTCAGCAGTTGGTCTTTTGTGGTTTGAGGGTTAGATACCTTGACA
GTGCGGACGTACTTGGAAATCGACTTGACCATCCCCATCATCTCTTTGCCACACTTGAATGCAATTTGGATACCCTTTGCCATTACCTTGAACTCGCCAT
ATACGCCGTACGTAGCGACAGATAGAGCTGCCTGGGCTACGGCCGACACCTTGCTCACGACTGCGAGCGCGCAGTCGTCATTCTGCCGGATGCATTCGAG
ACCGCACTCAACAGGGTAGGTAAAAGGACACTGGGCCCAGCAAGTTCCAAGCTTTCCGTCGAAACCGATCGGACATGTCTTCGCAATGTGGGCCTCTCGA
TAACACGCCGTGTCAGCTGCGGTGCCGAGAGCTGATCCTATCCAGTTTTTGTACGTGGAATCGATCGTACTGGTGGCGTTGAGACCGTTGCCAATGGTGA
ATCCTGCGTTCGCCGAAGACGACGTCCCAGACCCGGTTGTCGCCACAGAACCATCCACTGCTAGTGCGGAGTCGCTTTCATCGTCACTGTCGGAAGAGCT
GCCATCGTGGTGTATGTCGTCCTCACTGTCTACGGACTCGTCGTCGCTGTCCTCGTCGCCCGTTGACTGGAAGGTGACGGTTGCGGTAGTATTTACTGTG
TAGTTGGCGGCGGTCACCGTTGCAGCTGGGACGGATGCTGCGCTTGCGTTGAATGTGAATGATTGAGCTGAAACATTAAAAATTGCCACGAAGACGAGGA
CAAGCACCACGAATAACTTTGCCATAAGTCTCGCAAGGCGCGCAAAATTAAGAATGGCGTTCGACCGCCTAAACTCGAGCGTATCTGTATTACGTTCTTT
TATCGTGCTGGCATGCGGTGACCGTCTCAACACTTGTAGATTCGCGACCGTCGTGAGCCGCGCGACGCCCGGACATTATTAATCCAACCTTCAGACTTGT
ATCGAATCTAGTATTCCGGCGCAACGACGAATCTTGTAGGAAAAACGAGGACAACAGATCACCACGGGGCAATCGACGGGCGCTCTTCCAGTCGTTGGCG
GCCTCTGGTAGAAATCATTGGCATTGGCTAACACATTCGGAGTACATTTCATGGCCAGCTGGTTGACACAAGTGGCACAAAATTGGAGCGAAGAGTGAGA
GGGTCCGCCTTCGTGATTCAGTTGGCTGAGGCGAATGCTTTCTTAGAATCAATCGACGGGACCAGAACCTCCACGTGGGGCTACCAAAAGGATTGGCAGG
CCATAAATGGGCTCGCATATTGAAGGCCAAGCGATTTGCATTGACCCCAAAGATTCGGGTCGAAGTGCCAAACTGTCCGTGTCGATCACGTCAATACATG
AAGCAGGAGCGAGACGCTTTCGCTTGTGTGAGTGAACTTTACTACTCGTGCTGCGGCCCAAAATGTGCAGCCTTCACCAGGCGCTGTGGGACACTCGTTT
ACGATCGAGGCCCCGTTGAAGCACTGCAGTACACGTGCATGTGCTGCTGCAACCTCTCGCGTGCCTGGCTGAGGCGGGTGATAGCCGCGAGAGTCTCGCC
GAGACCGTCTCAAACTCGTCAATCGTTCGTACAATCGACCGCCAAACTCGAATCTACTCAGATACGCATTATCAGTTTAACAGCGCTAATACCTGAACTG
CTGGCAGCACGGCAAGTTCTGGACCGCCGACTTGTCTCCCTAAACAGCATGAGGTGATCCCGTTGGCATGGTCCCGTTGCCTCTCTACGGTACAGTACAG
CCACCAATATCCCGCCCGATCTGACGCAAGGAACACGACACCGCTGCAGTCCAGCTACAGGGTAACAACTCCCATCCGGGCCTTCCCTCCACGATTGTGC
TTGCCCAAACAATTTATCGGAGTCGGATTGCGAGGGAAATCACCCAAACATTTGCTTGGACGCGGCAGCTTTTCTCCTCAGCGTTTGCAAAAAATCCCGA
CGCGACTGCGCATCGCTGTAGTGCCTAGACACTCCTTCGTCGTGGTGACCTCCACCTTCAACACTGTTTTTTGCCTGATGCACTCCATCTTCCATTGCTC
TAATTTCGCCGCCTTTATCGTCAAACTCGCCTGACTGTTCATACGAAAGCGCATCCATTTCGTGGGCGAGTAGAAATTCACGGATCTTGTCGATCTGTCC
TCGCTCCGGAGCAAAGTTTGAGATCTCCACTTGGCCCGAAAGGTTGGCGATATCAAAAGCACGCTGAAACTTTGTTGACGAGAAAGGTAATGGTAGTGGC
GACTCCACACCAGCACTACATCCACCGGCAGCAGCAACCGGATCTACTACCGTGATCACTGGCACCAGAGCGGTTTTGTGCGGGAAGTAGTTGCAATTTT
CCGGGATGTCAACCTGCACCCGTATAACTGCAGCTTGGCACCCAGGGCGGTGCAAATCCAACTCCCGCGCCAGATACCCAGAGATTCGCGCTCCTACCGC
ACAGTGTTTCAACGCGACATCCAAAAATTTGTGCCACCGTGAGCTACGAACAGCAAATTAGCAATCGTTAGCGCTCAACTTTCCAAAGTTATCTAGACCT
TTAGTTGATACAGCAACTCACCGCTGTCGACTGCTTCCCCCACCATTTCCATGCAGATCTCCAGATTCCAGTTCGGGCAGTGGGTAGTCGTCGAAAAAGA
CACAGTCAAATTGGTCCAGCGTTGGTAACTGCTGCTGCCACGTACCCGCGACTATTTCCACTCCATTGCGACTAAATGCAAACTGCTGAGCGCGGTGTAG
TGTCTCCCGGTCGCATTCGATGATCGTGTGGCTTTTGGGTCGGAATGTCTGGATGCGAGAGGCCGAATATGCCAAGCCGAAGCCGATTTCCAGCACACGA
TCCGTTGGCTGGATGACGAGCGCGTCCACGCACAGTTCCATGTACTGCATCTCCCACCGCATCATGACCTGCTGCCCCCGAGAGCTCCAGAGGATCTCCT
GCCCGAGCTCATCGAGCCCCTTGACGTTGCCTTGCGTTGTCATTGAATCTGCTAAATATTTGTGATTTATATCGACCAAAAAATAGTCACCTATATTTAT
TAGCCACATTACTTTTATTGACAGACATTATTACAATCCTAAAACTTCCTCTCAGCTAACATTAAGCATCACGTTGAGCTGCAACATGCCGCCTTGGGTA
GACCGAGGGACCCAGAGCAATAACGAGCCGCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCG
CAGTCACGTTCGACGTCCACGTCACGGTCTCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGT
ATCGACGCTCTTGAACGTGATGGTTACAGTGCCGTCTCCAACCCTCGTCCACATGCCATCACTGTTGTTGAAGGCATCTTGAACGATCGACATCCCCAAT
GCTTTTTTTGCGGTACCGTCGTCAATTTCACCGATGAGCTTCGTGGGGCCACAGATGGGCTGAAAGTACTCTGAAATCGTGCTAGCAACGCCCCACAAAT
CCCAAATAGCGTAAAATGACGCTGCCTTGTCCGCAACCTTGAAAGCATAATCCTCGGCCTTCATAAATGTGCCATTGTTGCTCGTTCCGGAACTGATGAG
ATCGTCCACGATGCCTCCAAATGTCTTGCGTAGCGTGTCACGCGTGGCGTAGGCCGCAGCTTCATCCGATTCGGCAAGCAGCTCGTTCATGCAGTTATTT
GTCACGACGGGGATATCATTGAGCATTAGGTTCGATTGACTCATGGCCACACGAATATCGTCTTCAGAGATGAACGGGTCTTGCCTGCGTAGATCTGCCA
CGGTCATCCACGTGCGGTCTAGCAGTCGCTTCATGTCGTATCCGCACGTAGAATTCGATCCCATTGCGGACTTCAGTGATGTAATCTCAGTCTCGTTCAA
TGAGCCGATCGATTCGCCGAGTGTGATATTCTTCATGAAAGCTGCGAACGCGTCCCAACTGGAAACGATGGCATCGTCATTAGCCAACACTTCTTTCAAG
GTGTACTCTGCAGTGGTGAGAACTCGGTCCGCAAACTTGACGCTATCGTCGACCTTGATGTCGAGGCACGAGGCGATTGTCACTGGCAAGTCGATGATGA
TATTGTCTGACTGATACAGTACGGCGAGTAGTTTGCCTTGTGAAGTCTGCGGGTCGGAAACCTTGGTCGAGCGGACGTACTTGGCCAACGATTTGATTAA
GCCCAGCATATTCCTGGCGCACTTGACGGCAACTTGAAGGCCCTTCGCCAGCAATTTGAAGTCCCCGTACAAGCCGAGTGTGGCAAAGGACAGTGCCGAT
TGCACCACTACCGATACCTTGGTCACGAATGCGAGCGTACAGTCGTCGTTCTGCCGGATGCATTCAAGGCCGCACTCAAGGGGGTACGAGTACGGGCACT
GAGCCCAACACGTTCCCAGCTTTCCGCCGAAACCGAGCGGACACGCTTTGGCGATATGGGCTTCGCGATAGCATGCCGTCGAAGACGAGGTGTCCAGCGC
TGTACCAACCCAGTTCACATATGTAGACTCGATCGTGCTTGTAGCATTGGCAGCACTACCAATAGTGAATGCCGCATATCCTGAAGATAGCGAGGAACTC
ATTTGCGACCGAGACGCACTCACTGCCTGAGACGAGCTGTCGTCGCTGTCTGAAAAATCACCGTCGGTGCTGTCGGAAGAATCGTC