Description :
From Genome Similarity Track
Location :
Scaffold_117:2055- 4525
Sequence
2470 bases(100 bases per row)
CAGCATCGTGGATCTTGCCGCAATCCCGACACACGTAGAAACCGTGATCCCCGGGATGACCTTTTATTGCCACACTTCTCACAAACCAGATGTTTCCAAC
ACCCGGCTTCCGTATGCTTCCGGGATCCGCACCGCGAGCACCGGGTTGTTCCTGTCCCGTCAATGAGATCTCGGGATCTGTACATTCCACGATCCCCGGG
TTAGGAATCAACAGTGCGGTCGTTGTCTCCAGTCTTTGCCGTACGATGGTTGAGAACGGTGAGACAGACTCTGCGGTAATCCTCCGGATCGGAGTCCGAT
CCATCATATCCAGATTCAGTTCCTGAGCGGGCGCCCTGACGTGGTGGACTTGTCGGGCTGGGCCGTGAGTGTCGGTGCTTTTTGGCGAGACTTGCCGGAT
CCGACCGCTGCCTTCTTTTGGCGGGGTTTCGCGCAATCCACTGCCCGCAGCAGTTCTTCCAGCTCGTCGGCCTCTCGTAGCAGGGCCAACCTGTCGGCCA
GATCCACATCTCCCAACGTATCGATGAAATGATCCACGTGTTCCCGTAGCACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCAC
ATTTAGTCGAGGCAGGTATTCTAATGGGGGCTCGTCCGATCGACGGCGAGCATGGTAGTACTGTCGCGCTACCGACACCCCCAACCTGCAATACTGCGTT
TGGAATTCACGTAGAAAATTTGGCCACTTGTTCCTTATGGATCTACCCACTGCCGATACCAGTTTCTGGCTGGCCCAGCCAGCAAGTCCGCAAATGTCAG
ACACTTTTCTGCATCTGACGCTTGATCTCTCATGAGGGCTGACTTGACTTTTCTGATCCATGTTCGCGATTGGGCTTCGTCTTGATCCATGCCCGTGAAC
TCCTTCAGGCTGAGATCTGTACCCTCTGGATCATAGACGATCCATTGGTCCCGGCTGCAGCCGTTGCTACCGCCGCTGGCAAGGGGGATGGGACATCTAG
ATCATCTAGATCGAACTCATCATGGGTGTTGTCTTCCTCTACCGACCCCATTTCGACGTCTCATGCTCTATGGCCATGGGACATTTGCGTTTGTGGCCTG
GGGCATTCTCATACTTTGTTCGACCAGGAAACGACTCATCGCAGATTCGGAGTGCCGTTGTAAGGTGCCTGACGAGGTGTCGGAGGACACGGTAGCTGTA
GCCTGGCCTACCGTGGAGGAGGGTTTCGTGAGACGATTAACTGGAACCCAATCCGATGATAATCCAGCAGGGCTTCTTGCTGGATCTGGCCCGACCCTGG
CTAGATGGTATCAGATCGCGGGTATGGCGCACTGGATTCCGTGTCTCCTGTCCACGGAGCCTTGCTCGTGCTTCCAGCATTGATTCCCCGAAAGGACCTA
AGGCCATGCGTCGCGGCTCGGAAGACGTATCTGATCCATCTTCGGCCGCGGATTAAAATTTTGAGGATGCAGCTTGGCTGATCCTCGGCGACGACACTGG
ATCCATGGTCTGCGGCTTTTCCCCGGTGATGGACTTGACTCTGACGAAAAAGACCCACGTCGCCAATAATATGAGATCCATACCTAGCTCCAAGATATCC
TCCGCATCGAACGCACCAGCCAGGATGCCCGAATCCGTAAGCAGACGTAATAGAACCTTAGCTGCCACTAATTTGTTCGACGTCTTCGTTGGAGCTCTCA
CCGGTTCCCTTGGATCTTCGATCTGTCGTGAATTCAGGATCCGCATGACAGGATCTTGATAGAGGAAGTCGCGTAAAGCTTGGTGGCGATATACAAACTC
GAGATCCTTGCCGGACCAGCTTGACCTGGATACAGCTTGGTCTTCTTCCAACTCTGGATCTTGCATCTTCTTCCGCGCAGGCTTAGTTGTATCAGTCTTT
TTCTCATCCTTTCGACTAGCAGGCTTGGGTTTAGGTACGGTGTTAACTTGACCGGTGAATATACAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTT
TGTTAGCGGATCTTGACGCAAGTCGGATCCTGGCACAGGTCAAGATCCGCAGAGGCCCCGAGGGGCCCTGAGGAGGATAGAGAGGTTTCTCTGCTAGATC
CGGATCCATCTTTTTTCCGTCGACAGAGTCCTCCCAGGACTTCATCGATCCGACCCCCGATGATGCCTCTTCTCCTGGCTCAATCTTCACTTGAGCATCT
TCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTGGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCT
GACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCTCGATGATCCGGGATCTGCTGAACTTTTCTCACCTTGTGTAGGTGTCGGTAGGGCGG
GATCTTGCTCTCTCGGTAACTTCTGAAGCGCTCAAGTGGTGAGGCTTGAGTGTCTTGGCGAGACGTGGGG