Description :
From Genome Similarity Track
Location :
Scaffold_238:2054- 3948
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_238-fgenesh-gene-0.0RabGAP

Sequence
1894 bases(100 bases per row)
GACGGACGACGCCAGCTCGGCAACGTGCTCAAAGCCACGGCTGTTCACGCCCCAGAGGTCGCGTACTGCCAGGTATCCTCTCTTTTTGTGATTGTCCGAG
AGCCTAACAGACTCCAATGAACTCACGATGCACAATTGCAAACTTGGCCTGATAGGGAATGAACTACGTAGCAGCGCTGTTGTTGATGATGTTGAATGAA
GACAACCTCGAGCTTCAAGACGAGGGTGAGCTGTCACCGGAGAGCAGCAACGAGTCGCCCGAGGAGACTGCTTTCTGGATACTCTACGCGCTCATCCGTA
ACCAGGGGATGGCCGACGTCTGGCGCAGTAAGATGCCTGGGTACGTGTCGAATACGAAAATGACATGGCTTTACTATCAAGGGTATCATTTTTTTAATTC
CAAGTGTGGAAATGGGATTGATCCAGGCTCTCGAGGTGTATCTACCTGTACAACCAGCTGCTGCAGATTCACTTTTACGATCTGCATGTGCATCTGCGGC
ACATTGGCATGCACCCGAGCTTCCTCGCAACCCAGGTATGTCTGCGCGTCTCTCACTGTGTCCGGGCTAATTATTGTTGAACGCGAGTGTGATGTAAATC
TATTGTTTAGTGGTTTGTGACACTCTTTGCGCGAGTGCTGCCAGCGCAGAGCGTGCACCGCGTCTGGGACCTTTTTCTATTGGATGGCTGGAAAATGGTG
TTTCGCGTCGCGCTGGCCATCACAGCCCACCTTCGCCCGTTTATGCTAAAGATGGTGCGTGTGGCTGACTCGTTCTGATGGCTGTTAGAAGGAGCTACCC
GGGCTCACTCGATGCTTTGCTGCTTGTTAGGACATGGAGGAGTGCAGCGATTTCTTTCGACAGAATCCAAAGCTGCGACTGGATACGATCACGGTCGATG
AGCTCATTTCCAGTGCGCTGACCTATAAAATCACAAGGGAAACGCTGACAAAGATGGAGGACGAGCGTCAGATGGAGGTGAGGTCGTAGTACAACTTTGT
TACTTTTCACTTCAGTGTGTGGACTGATCACCCTTTAACCTTGTGCCACAGTATCTCCGCCTTCGGCTCCAGAAGACGCCGCTCTCCTACGAACATAGTG
TGTTGTTCCCAAACCTGGAAGAAAACGAAGCAGGCCACAGCTCTTCCCTCAACCTCATCCGGTCCCAGCTTGAGCACTTTGACACAGACGTTGCGAGCGA
CACCGTAGTGCTGCGACAAAAGATCGAGGACATTGACAAGTCGCTCGCGACCGCGACCGCAACACTCTACGAAGCCAGCTACGCGCTTACAGAAGCTACT
TTTGAGCTGGAAGACCATTTAGAGGCCAAGCAGCGGCTTCGTGCCCAGTTCCAGGCGCTGTCTGTGATCGCAGTTGCTGAAGCGACGTCACCGTCTCCAT
CACAACTTGGTGGAGATGGGGATGGGAAAAGCAAGAATGCGATCCAGCTCTGGAGCCCAGCGGCGACTATGGCGTACATCAACAGCCGCATGTACGGCTG
CCTGGAGCGTGCGACGCGGCTATCGATGCTCTCGAGTCGGGGCGAGTCCCAGCGCGACTTCGACGAGTACGACGCCGAGCGCGAGGAAGAGGACCGGAAG
CTGTCGCACCTGGAAATCCTCGTGCCGCGTCTCGCTGCCGACCTCAAGGCGATCCAGAAGAAGATGGACGCGAATGAGAAGCTGCTCCAGGGGATGCAGG
ACAAGTACGGCAAGCTCCAGCGCGCCTCTCAGCTGGCCCAGGTGGCGCTGGAGGAGCTGCAGCAGTTCAAAGACCGCCTGGCTGACCAAATGCTGCAGCT
CCTACTCGCGTCCGAGCGCCTCAAGAACTCCAAGATGCAGCAGCTCTTTGCAGAGGTCGATCGCGTGGGGTGAGTCAGACAGAGAGAGTGAGAG