Description :
From Genome Similarity Track
Location :
Scaffold_53:2054- 19707
Transcript NameFunction/comments
Phymu_g2815hypothetical protein PHYSODRAFT_315962
Phymu_g2816pumilio-like mating protein M90
Phymu_g2817hypothetical protein PHYSODRAFT_507586
Phymu_g2818conserved hypothetical protein
Phymu_g2819hypothetical protein PHYSODRAFT_315958
Phymu_g2820protein phosphatase 2C, putative
Phymu_g2821hypothetical protein PHYSODRAFT_505107

Sequence
17653 bases(100 bases per row)
AGCATGAGCGACGTGCAATCGCTCAGTGACTCGCCGGCGTCGTCCGTGGGGCTTGGCAACTCGCTCACGTGGGAGAAAGTAGTGCTGTCGCCGCCGGAGC
TCCTGTCagtgcagctggagcacgagctgcagcacgcagaggaagaagctgcatcTGCGTGTTCTGAGAGGCAGAATAAGAATGGTGTGGATATCGATGC
CAAGACGGGCAAGGCCGCAGGTCGCGTAATTGTTGAGGTGCTGCAAGCTAAAGACCTGGAGCTGAAGAATAACGCAGCAGTTCAGGCGATCAGTGCCAAT
GTGCAGCCAGAGCTGTACGTATCGACACAGGTGACTCCCCTCTCAGCGttcgagaagagcacgaaaaAGCACTTGCGTACTAGTGGTGTGCAAGCTGTCG
ATAATTCAACTGTAAGCTGGAAGGAGTCACTAGTGTATGAAGGCGCCAAAACCAAGAAGTTCGGCATTAAGGTCTCATTGAGCTGCAGTGCTCAGGTGAT
TGCGGATGTGGTGCTTGGAGAGTTGGAGCTGCGTAGTGCTGACTATGAGGACCAGGCAACCCTTGAAAAGTGGTATGACCTGAAGGTGCCGTCGTCTACC
GTAATGACCGGTGTTACTGGAAAATTATTGCTGCGCGTCACGTTTGAGTACTCCGTTCGTGACCGCCGTGAGCGTCACATAACTCTTCTCCGACAaaaga
agctcgagaacgaTGGGAATatcgagaagtacaagacCACGGCGCGGCAGGTAAATGCTCCTGTAAGACACCCTGCAGCATTTGGCAAAGAGACGGCAAA
GGCTGCGTTGTACGTGCCTGGTAACAAATTCCACATCGAAAAGCACAACCCGGCTGCTGTAAGTGTAGCACCCCTGGCGGATAAGACGCGCATTGTGACT
CCATTTGGACGAGGAGTTGTGGTGTCATTTCGACCGGATACCAAGATGTATGTGGTGCAGATGGACACAGATGCTGCATCGAAGAACCACACCATGGCCT
ACCTTCGCCAGACTGTCGTGAACGAAGAACCCGATGAGCCGCATCTCCGTATGCACATGAAGGTGGCGACGCCGTATGGCCTGGGTGTATTGGAGGAGAT
CCGACCTAACGACAACGTCCTGATCGTTAAGACCGACTACGCTTGTATGTTCATGCAGCGCAAGGATGTCAAGCTGCCAACAAAAGATATATCAGAGATG
TCGACGAAGGATCTGGTGAACGAGGCCACCAAGCTTGCAGACACAGGTAATGACGAGTTCCGTGAAGGCAAGCTCCAGGACGCCGTATACAGCTACTTGC
GCTCTCTAGGCTTTCTCCAGCGTGTGGACCAGGACAACGCTACTCACAAGGAAAAAGCAACTATTATTCAGACCATGATCCGCTGCCACCTTAACATTGG
TGCCTGCAAATTGAAGCTGAACACGTACGCGGATGCCGAGGTCGCGTGCACGAACGCCTTGAGCATCCTCACTGTACTGGCCGAGAACCGCGAGGGCAAT
GTCGTTACCTGGATGGGGCGTCTGGGCATGTCAGAGCAGCTCATGTTCGAGGACTGGCCGTCCAAGGCGCGCTTCCGCCGCGCCCAAGCGTGTGTTAAGC
TGGAGAAGTATGCGGACGCCAAACAGGATTTACTGCTGGCGGTGAAGCTTAACCCTCGAGATAAGTCGTGCCGCACACTGCTTGAGAAGGTGAGCAAGTT
GGTGGACAAGCAGAGGCGCGACGAAAGGAAGGCCTGGGGCGGCATTTTTGAGAACCTTGACGCTGACGCGTCGACCGCCAAAATCGCGGCGATGACTAAG
ACGACGACTACCAAGAGGACGACCGCTGGTAACAGCGCAAGCAGCGAGGAAAAGTCGATCTTCACACGCAAAACCAAGAGGCAGCAGGTGAAGGTATCAG
CAACATCCAACGATGCAGCCGAGCCATGGTACTTGACCACGTCCGCGCTGGCCACGGCGTCGGTGGTGACGGCGGGTGTGGCAGCCGTagcgttgctggc
gctgaAGCCCAAGAGCTCGTAAGCGGCGACTGACACGCACGTATCCTGTGCaggcacttcaacttcagggGCTGGCTCTCTTCGTGAGCTGGCATCTGCG
GTTAGACTGAGTCGATCGGCTACGCTGCCGACTCCACTTGGCTACAGGCAGGGCATGGCCTTCGTTCAGGGCAGTCAGCACCTGGGACAGGGCCTACTCA
ACGTGTGGGTGCGAGCGAGATTTACGTTCCGCGCCGCCGTATAACTCGCGCCGCCCCCTCGCTTTAGCACTAGTGATTCACTAGTAGTGAAGCAAAACAC
GAACCTTTGTTGAAAAATGGTATCCGCAACTAGAGCCGGTCTCCTCAATGTTTCCTTTGTATAAAGCGACCAGGCGGTAGTGCTTTAAGCgaaagggggg
ggggggcaaCTTGCATCCTGCTTGCTCGAACGCCAGTCAATTTCTGTCATCGATATCGCTGCCtttgcttctgctcgctAGCCAGCGTACACCGCGCCAG
ACAGCGGATGTCCGCAGTTATAGCTGCCGCGTCGTAATACCGTCGTTGCCTGTCACCAAGATGTGTCGTTGGCGAGTGCAAACCGGCTGGCGGCACCGAC
ACCTTGCCTTTTTGccggagtgatggtcgctgCCCCTTCTCGGAACGCGTGTTGACGATCCCAGGCTGTCCcgcgtcgcttcaactttgcCGTTAGCATA
ACGCTCGCGCTTCCACCTTTTCTTCCGACCTCTGCTGTCGACGACAGACGGAAACCCCAGTCGgcgagcaacagcagcggcagccagCGGTAACGACTGC
GCCAGTCAAGTCGAGTCACATCACACACCGCCTCGACACATGCGTGCCTCGGATTTTTCCATGAAAGGTTGCTAATTGCTTCGGCAGTGAACTGCACGCA
GTGAAATTTCCGATGCGAGCAGACCACGACTACCTCGGCCGGTTAACCGCTAGGAGGGAGAATGACATCGCCAGCTATAGTCTGCGGAGCTCCCCGCCCC
CGCAGTTTCGTGCGGTGATGTTACACACCCGCCATCTCAGACGCCGCGGACGCGCGGTCGTTGAAAATTCTCGCTTCGAGATGGTCTTCAGTGCAGTTTT
GCGAGTGCAATCTCTGGCAAAAGGAAAGACACTCGCTTAACCCTCATCGTCGTTTCCGTCTTTTTTGCACGCCCGACGTCAACGGCGTTGGGTGGGTCCT
CTCGCTTTAAGCCAAAGTGAAAAGCAACCTGTCACAGAGCCCGTTTCGCGAAAATAACCCCTCCCAGGCCCACCCGCCCGCGTCCATAGCggctcattct
ccaatttgccCCCTCCAGCGCAAGTGGGCCCGTTGGAGCATTGCGGCGTTTCAGCGGCACTCGACGCCTAGTAACAGCTCGGTTGCCTGCCTGCCTGCCT
TGGGTCGCCTTCCATGGGACACAGCAACTCAATGAGTCCCACCAAGAGCATCGATGGCTGCACCCCCTCCTCGATCGCACCGCTGCAACGCGCTGCCAAC
AGCCACGCCGGATCGAGTCTCCCTGCAATGGAGAAGCCTGTCCACCACGACAACCCCGTCGAACCTGTgcgcgtgaagctgcaggatcCCGTCGGATGCC
CTCCGTCTGACGCTCTCTGGTCATCCGAAGGGCTAAAGTCGCGTTCCTCGCTGCTATTCTCCGCCTCGCAGGCACTAAGCGAGCGCCCAGCTAGCTTCGC
ACTTCGTGCCCCACGGCTGCGAGCCAAGACGGACGTGCGCTCCGTGCACAGTGGCCAGACGACGCCGCCGAGCGAGTCAGACGAAGGCGAGACCGCGGTG
GACAACCAGAAGGAAGACGAAAACGAGCACGATGCCTCATCTGAGAACGCCGAGGAACTATCGTCGTCATGGGGGAAAACAAAGAAACGGTCGAGTAAGG
TAATTTATCCGTTGTGGTTTAGCCGCTGGAAATGATGCAAGACTTGGGTCTGACGCAGTGGGTTCACATGTTTGTTTGTGCAGGAGAATCAACCGATCGA
TAACCAGGAGTCAGAAACGCATGGGCTGCCGTTCAATCTGGTATGTGTGGCTGAACGCAGCTCTTTTAGTGCTACCTTTAATTAACTGTTCTGCTTTTTG
GGCCAGCTCGGAGATCGCGAGAGCGAGCCTCGGTCTCGGAGCAGTGAATCACACCAAGTGAATATCTGGACAAATCCGAACAACGACTTCGATAACGGTG
ATTTTAACTCGACTGTGAGCCCCACTACGTCACCTGACAAGCAGAGTTTCCCACACACAAGCGCGACCACCTCCCGGGCCATCCCGACAGGATCATTCCG
TGGTGATACCAAGACTGTTGGACGCCGAGTGCCTCCTGGAATGTCCTTGATCGACCGAATTCAAGAGGATTTTCCTCGGACGCCATCCCCTGAGTACGGA
CCGTTCGAAGGAGAGGGCATGACTGCTCGTAGGCCTTCATTCAGCGGGCGAGACCACCAGAGCCAGGCGATGTTCGACATCAATGAAGGAGTGGGCCAGT
TACGACTTGGCAACTATCGTACAGCCCCTCCCTACGATAATGACCGTCGCAATGGGAATGACTTCGGAGTTTTTTCTCGGATTCCGCAGCACATTGCTGA
CCCCAGAGTCAATGGAGTCAACGGCCACCGTCACACTTTCGGCAGGAGTACTAGCGAGCCCCCGTTCGGTGGTTCTTATCATGGAGCTATGGATCAGGGC
TACCCGTTGTCTTACACCATGGGTGCTCAAGGTTATCCTGTCATGATGGGTGCTGGCAAGTCGCGGTGGTCTGCCAGCGAGGATGTCTACGCATTCCCAT
CGTCTCCTTTCGGTTTTGTTCCGCCGGATTTTGCAGGATCACATCCTGCACACACACCTGCCATGCCGAATTATCCGGCTGGCTATGCTGGGGAGTTCCG
CAGCATGAAACCCGCTGACAAGATGTTCAAAGCGCGCCCGGCATATCCCCTTACAGATCATCCTCTGTATGAGCGTCACGACTTCGGAGGTTACGTGCCT
CGTCCGCAGATGCTGCATCGACCTAAAGTCATGGGTGCTCGACGAAATGAATTCGAGTATTTTCACCCGGTTGCTCATTCGTACTCGTCCACCAGTCTAC
TGGAGGAGTTCAACTCGTCGCCAAAGTCGGAGAAATGGGGATTGTCCGCCATCAAAGGAcacctcttcatcttcgcgAAAGATCAGACAGGCTCGCGTTT
TAttcagcagaagctggagaaagcagATGAGCGCCTAAAAGCTGATGCATTCAGTGAGATTTTCCCAAACTCTCTCCTGTTGATGACGGATGTTTTCGGC
AACTACGTGATCCAGAAATTTCTCGAGTATGGTTctctggagcagcaacagctacTGGTGGAGTTGATGACAAGCAACATGATCAGCCTGGCCTTGCAAG
TTTACGGGTGCCGTGTGATCCAGCGTGCCCTAGAAGTGACtcgagttgaagagcagcttgCGCTGATTCGACAGTTGAAGGGGCACGTAATGAAGTGCGT
CGTTGACCAGAACGGCAaccacgtgctgcagaagtGCATCGAGGCAGCATCTTGGAAGAGAGCAGCTGAGTGCAACGGACTCGGCCCCCAGCGTTTCGTG
ACCGGAGACGACATCCAGTTCATCATCGACAGCTTTGTCGGCCACGCTGCTGCGCTCTCCACCCACTCATACGGCTGCCGTGTGATCCAGCGCGTACTAG
AGCACTGTGCGCCGAGCAAAATTCGCCCGTTGCTGGATGAAATTATCTACAAGTGTCGCGAACTTGTTAAGGACCAGTTTGGCAACTACGTCGTGCAGCA
TGTTATAAGTCATGGCGAGACTGACCAGCGCAACATCGTCATGCAAGCAGTGCTTCCTGAAATCGCTCGCTGGAGTCAACACAAATACGCCAGCAACGTT
GTGGAATCCTGCTTGGAGCacgcgacgaagaaggaaatTAGCCAGATTGTTGACTTTATCCTTCAGTGTGACGACAGCGGAGCGTCCTGTGCACTACTGC
CTATGATGAAACACATGTACGGCAACTACGTGGTGCAGAAATTGCTGGAGCGCGCGGATGACCACGACCGCCACCGCATTGTATGTATTATTCGCCACAA
CGAAGACTATTTGAAGCGCTTCACCTTTGGAAAACACGTTTTGAGCCGgctggagcgcgaggagcAGGCGGTAACACACGACTATTACTGAGCAGACGAG
CTTCTGCTATAACAGCAACGGCACTGGGAGGTGGGGTAACAACACAGCAGCCCCTTGACATGctcctgcgcttcctgccCTCTACACTACCTATATAAAT
ATTTTGCGGCGCGATGACGAGCTGATTCACGCCGAGTTGAGTTCATGACCACGACAAAAGTTTGAGCGTACGATACACGGGCCACGACACCAAAACAAAT
AAATAAGTTCAACTGGTTTTTTTGATTCAATAGTCGTTCGCGTTGAAGTTATCCGACCAGAACTATTCCGATACAGAGTGCTTAATCTCGCCGTGTACCC
ACCCACAGCTCCTGATCTACAGCTCTTGAAGCGCACGTGCAAcctgcgctgctgcacgcgtGCCAGTATCCACTGCGGCATGCACAGACATTCCAGGCTG
CTCGAATGCTGTGGCTTCTCCCGCGAAGAAAATACGGTCGTCTACGGGGGCAGCCAAGTCATGAGAAGCGGAATCTGACTGGCCTACGCGTGGGAAGGCA
TATCCACCACCAATCCACGGTTCATCACCAAAGTCCTTGTAGATTCCCTTGACAAAGTGCTTGCGCGCTGGAGACGGCTCGTCCACGGTACCGTAGATCA
TGTCAAGCTGGTCGAGGAAACCCTCAACGATTTTCTCGTGGTCCATGCCGACGAAGGTTTCCGCATAGAGCGCGCCGGCAAAACCCGTTATCAAATACTG
CGTTTTGCTATCGTCAGTCTTGTTGgactcttcttcaacgcacAACATGTCGCCATTGGGCTTTAGGTGACCAATTCCGTTTGTGCTGTTGAACCAAAAC
TCAGGCAGGAAGCAGTCCGAGCACACGACTCCGTGCGCATTCTCAGGCCAGAAGCGACCCGACATGTGCAACAGCACCTTGCCAGCGCGACGCATGTCAA
AGGACGCAACGGCGTCAATCTTTTCCAGCGGAAGGGCCGGGGTATAGGCAATCTTGGAGAAGACGGCTGTCGAGACAGTGACAACTAACGTGCGGCACGA
CAGTTGCTTGCCCGACGTGCTGGTCACCAAGATTCTGCCGCTCTCGGAGTAGTCTACGCTGGCCACAGGCCAGTTTAGACGAGTCGCCACCCCCTCAGCG
AAGTGATCTACAAAGCGCATGAAGCTCGGCACAACACGGTAGTCgccctcgtcctccagttcaATCCATTGCTTCTCATAGCGACACGTAATGCGCATCG
AAATGTCCTCCAGTGGCCCACCCGCTGTGTTTGCGTATCCGGATTCGCATAGCTTCATCATTGAAGGCGACAATCCGATCTCATTGAAGTAATCTCTCAT
GGACTTCTCGGGCGGGATCTGATCAATGTTCTCAAGATCGCTCAAGTCAGCCACGGACATATTAAACTTGAGAaactcctcgtcttcatcgtcataCTTC
AGCATGCGCTTCTGATCGCCGATGTAGTAATATCCGATGCCTCCATCCGGAGCAGGCTCAGTCGGACCACCATCTCCCTACACACGCAATAAATCAATAG
GGTCGTGAGCATCGACTGAGAAGGACTAACTAAAGAGAGTACACTCCACTCTACACTACCGTATGCATATTTTCTGAGTAATGGAATGTATGAATCCAGA
CTGACTTCTCCCGGGTGGACACGTACAAGACTCAACAACACAAGAACTGTGCCGTCGAATGCACGCAGAGAGCAACAAACCCCCCCCGAAGGAGGCCATG
CCGCTCGCCCTGGAGATGCTAATTAAGGAAACATGATCTGACGTTCGCTTTTGCATTCGTATGAAGGCCAGAAGATTATCTCAAAGCTCTTTCGAGCGAA
TCAGTGGCTGATTAATCGATGCGGCTACCATAAAATACAGGAATTTACGTGCACTGTGTCATATCCTCACCTGAGCCCAAGTGAAGATCTCGCGAAGACC
GATGTTGTGTTGTTCCGCCATGCGTGTGAGCGTCGTGTTGGCACCGTGCATGAACTCGGCGCCCACCTCAATGCTCATCCCGGGGATAAAGCTGGTGTTA
TTCATCACGCGGCCGCCTATGCGGTCGGAGGCCTCCACAACCACCACGTCCTTGACGCCCTTGGTGTGGGTTAGCTGACTGGCGCAGCGCAGACCAGCGA
CACCAGCGCCGATGACGACTACGTCGTGGAACTCCGGCTGCTCGCCGGCCATTGTGAGTTGGTCGATCGTTCACTCGCTAAATCTGAAATGGGCTCAAGA
CAGCGGAAACTAGGGCCCCATGCTTGCCATGATGGCACGCGTGTGTCTGTACCAGGGACCACCAATCCAAGAATGACAATCGCGCTGCATTTTTGTGTTT
AGCACTTTGACTGGACAGCAGACTGCTCGGACGAAATAACTAGGATAAAGTATGGATGGGAGTACAGTAAAGGACGATGTACTTTATAAGACGAAATACA
AGGTACCAGCAACATAACAATTGTTGCAACGTAAAAAATGGTGTTTGAGTGTGAACCGGTACCTTACTGGTACATATACCGGCATTTCGATGCAGTTGAA
GTCCGTTCTGATCATGCGAAAACCTACCTGTTCGCAGAGGTTGGCATGTGCTGCATAAAGATGAAAGATGCCATTCGCTAGCAATTGGGCGAGTGCTCGC
AATGCATCTGCAAGTTGCAAAGGTGCGAGAGGTGACAGTTGATTCCTGCCCGGCCACGTCACTCGTCCACAACTCAGGCAAAGCCTGTGCGTCAGCAAGT
CGCTTGGTTTTGGTATAGGACGAGAAACCCGTCTATACCGATCGCATTCCTCCGCCAAACCGCAACTCATTCGCCTTTTCCTCCCTGTGCGCGCACGTGa
cctcctctttctcttctctAAACCGCAATGTCCGACCTCAAGACCGAATTCGAAGCGGCTGCCGCCCTCGTGAAGACGTTCACCAAGAACCCGGTGCGTT
AATACCGTCTCCCATTGTCTAACGAGCTCAACTGACATCGCATTTGTGTGTGTTGTGCAGtccaacgacgagaagctggccCTGTACGCGTACTACAAGC
AGGCCACTGTGGGTGACAACACGACGCCCGCCCCAGGCATGTTTGACCTGACGGGCAAGGCCAAGTGGAACGCctggaacgccaagaagggcGTGTCCAC
GGAGGACGCCATGAAGGCCTACATCgccgaggtggagaagcagaaggccgTTTACGCCTGAAGCGCGGCCGCCAAGTCGCGTCTGtagcttcttctcctt
gtttGCAGTCTCAGCTGCTGGCCCCAGTTACCGGTTGCATGCGCAGTTTTGGACGTGAGGGCTGGCTCAAGCTGCTAAGGTAGGAATTGGCGACGATCGA
CCCGGCGCCTGCTTCAGTTCATTAGTCGATGACGTCTTCGTAAAAGTCTCATAAAAAATGTTATCGGAAGACGAGTGTTTTCTCTTTAAGCTACAATGAC
AGGCTCGTGTAACTTTCCTCTTATGAAAAAAACTGAAATGTGGCGCAAAGCTTCGAACGCACCGAGTGCTCGGTACAGCTTGCTTGGTATGGGAGCCGCG
AGTCAGTTGTAGGTTTGTTGAATAATTATCGCCGGCTACGACACTGACAACAATGGGCCTCTCGTGCTCGCCGGCAGTAAATGAGCGACCCCACGCAATC
CAAGCTATCCATGTGAATATGATACCTTTGAAAGCCCTCTGCCTTGCTGCCATCCCTTTCCAACGGTGAGTACAGACGGCGGCAAGTGAGAGTATGTCGG
GCTTGAAATGGCTGCTCATTTCAACCTGCCATCCCCGACTTTGGCCTCGACTTTTGCCTCCATTCGGGCGAAATCGACCATGAGTTGGTTGATCTGTGCC
GTATGCTGCCCCAGCTTCGTGTTGAGCGAAATCTGCTGCACGgccaactgctgctgcgtctcaGTGTTTTGCGTCAGGAGACGCATGAGAAGCACCTCCA
TCTGCTCACCCGCCGAGGTTGTTCCCATGGAAAGCTGCGTCATGGCCATTGACTCGCTTTCTTCGTTCtcactgctgtcgttgttATCTCCCTTCTGCGG
CGATAGCGACGACTGCGCCGACGACGACCCAAATGACGACATGGACGAGGTCGTAGCTGAAGTTGATGGAGACATCGGCACCGCGATCTTTCCCCTGCCA
AAGCTTTGGAGCCCGTTGTGAGCGGCAACTTGGACCAGATCAGTGACTTCGTGTGCAttgttctccagctccgtgcTGAGTTCGTTGTCTGTCTGCAGTT
CAAGTGCGGGGAGattttcagcagcagccaacgctAGACGCTCCAAAATGGAGATATCGCAAGCCTCTCGAGGACGTGTGTCGAGAACGAAGACACTGCC
GACGGCATGTCCCGAGTTCGGGTCAATTATCGGGGCCGCAGCGTAGAAGCGAACACTGGCGGCACCCGAAACGAGCGGGTTCTTTTGGAACCGGTTGTCC
TGAAGCGTGTCAAGCACAACCATCGGCTCGAGCGTGTGCACTGTGTAGGCGCAGAAAGCGATCTTCCGCGGGATCATCTTATGTGCTAGCCCCACACTAG
CCTTGAACCACTGACGGTGCTCGTCCAAGAAACTCACCGCAGCCATCGGACACGACAGACGCGCCTTGGCCAGGTCGCAGATCATGTCGAAAGGCTtctc
cgactcggagtcgAGGATCTTAAGCGCATGCAAGGCTCGGAGGCGAGCTCCTTCGTTAGCGCTCACTGGTGGTCGGGGCCACGGGTGGGCCCACTCGGAC
GACGGCTCGTTGCTCTGCTGTTCGACCTGAAGGTTTCTCCTGTGACTGCTCGTGGATTCGCCCtcggcgttgaagtggccgtCTCTGAGCTCCAAGTGTT
GGCGTGCCTTGGGTGTGAGAGAacgaagcagctcttcgCAGTCGGGTTCAGAAGAAGGGCCTGATGCAGGCGACTGTAGGTGGTTCTGCAGCCACACGCG
AGACGCCTCCGACGTCGCACTAAGATGTGGTGCTGAAGCGTCGATTGATCGACGCTGGTTTGAATTGTTGATCACGCAGGACATGCACACGCGGACGCGG
GTGGGCTCAAGCGTCGGGTCCACGTTGGCGTCCTTGTAGAGCGTGCAATTCTTGCAAACCACCTCACCACACTGCAGTAGACAGGCAACAAGCAAAAACG
TCAGAAAGCTACTCGCAGCAGTGTTGATACATGCACAAAGGAGAAAGCTCACCATGCGGCAGTGGTGTTTGCGCCGGAAAGTGCCGAACGGCCTGGTGCA
GACATAGCAAAGGTTGCGTTCATGGTCGGCGACCCAGTCGGCCGAGTCCACGAGGTGCAGTACAAAGAAGTCGTCGGCCGCCATCTTCAGTGCTGCAGGA
GTATGACTGAGCGCGCAGCGTTTGCTGGGCGACGCACTTGTCTGGCTTGGGCAAAGTTGACGAATGGCGCCGCTTGTGTCCAGGCAACGTGTCGATCGAG
CGAAACGCTTTCCACCGCGCTTTGATGTTTCTTCGAGCAAGGCGAGAAGGAGTCGGTGGGCCACAAACGCAAGAAAGCAATTCGAGCGTCGGAGGCAACG
CGATTTTTCTGGCTTGTGGCAGTTGTTATTTTTCGATTAAGCCGCCCAACGCCCGCGACCTCCATTTTTGCGTAGCAACGCTCGTCGGAGAACTCCACGG
ACTTCTGTTCCGGGCGTTGACCAAGGCTCTTGACAGCGTGTGAAAATCCCTTAAGCTGGAAAAGTGGGGCATGCAATTCTACACGCGTCGTACGATCCAC
CCGAGTGAACCCAGAGTTTCTCCGCAGACAGAAAGCACTTCCCGGTCGACATGCATGTAATTCTCGATGATATTCCGCCCGACTTGAGTCAGGGCAGAAG
GTGAAACGAACATTCAGGCGTCACGATCTTCAGAGTTAGTACTTTCGTGTTCGCCGTGTGCCACTGTTCCCTGTCCACCTTACTTCATGTACAGCAACAC
TCGAGTTTACGAGATCTGTACGTGAGTCAGGCGAAGAGCACAGCGCAGCGCCCAATTATCAGATTGCTTACCGCTTCATTCATTGTCCACGCATCATCAC
TTGCGGCTAATGTACCGACAAAAGCCTCGATGCGTGAACGAATTGCTGAAATGGCATCCACAATTTGAGAGCCCAATGCGAATGACCTAGCTCAACACGT
CTACTTGTCGTCAGAGCGAGCGTCCGACATCCCCACAAACTGTTGCGGACAGCACTTGCCGTCTCAGTGCCAGACGTTCCGCGAATGTCTCCATCTGCCT
GGTGGACGGAGTTCACTTGGCCACTACTTCCACCTCTGCCTGATGCCCCTGTTTCACTATCAGACTTCTAAAAGCCGTACGGCACAAAACACAATACTGT
AGCAACGCAGTTGAGTACTTGTAATGTCTGGAGTTTCCGCGTTTGTTTGCTGGAAAACAACTAAAATGCTGAAACAAACTTACCAGTGGAAGGACATTTG
CACTTCAAGTACTGTTCTTCAACCTGACAACGCGACGTAGCATtacgccttcttcgacgttACATAACGCCTGTCTTCCTTTTTGTCGCCCCCTTTATCA
AGCTGGGCAAGCGTTGAACATGCGACTTTTTGCGGCGCGAAACCTGGCGCGCTTAGCACGTGGACAGAGCCACAAGGTGCGAACACGCGTCATCCCTGGA
TCCCCCTCACTTATTCCTGCACGATGCCGCTCTCACCGAGAATTTAGGCCTCCTAGAAGCTTCACAATCTTCGTTCCAAACTCACCCCTGTGCTGTCATT
TATTCGCCGCAGTTTCATGGATCAGCATTGCGCCAGGCGCTGTTCCTAAGCGGCTTGGGGCTAtcggtgctggcgcttgCCCATGCTGAACTTACGGATG
TTAACTCTGCTCACTTGGAAGCCCAATGTGACGCCCGCTACGCCCCGCCCGAGGTGGACGGGGCCTTCTCTGTGCCTCTTGAGCGCGAGGAGTTCACGCC
CATTGCCAAGTCGCGCGCCACGCGGCTCAGCAGCGCGTCGTACAAAGCCAATTTCCCCATTGAGGACAAGTACGCGGTGGAAACGACGGACTCGGGGGAC
GTGTTTGCGGCCGTACTGGATGGCCATGGTACGGCCTTTGCTTTGCAAAAGATTCTGTTTGCATTTTCTAAACCTTTTGTCTGTCTATTCAGGCGGCTGG
CAGGTGTCGGAGTATGCGCGTAAAACGCTGATCGGCAacgtgcagaaggagctgtcgTATCTGTACAAGCCGGGCACGACCGAGCCAGCTcaaggcgacg
acgagtcGGTCTCGGATGACCGCGTGGCGGCTGCTATCCAGCGTGCTTTCGGACGCACGGACCGTGACCTCATGTCAGAGGTGGCGTCGGCTTTCAAGCT
GGGGTTTGGAGCTGTGGCACGTTGCGGATCATGCGCGTGCCTGGCCTACGTGCACGAAGGCAGCGTTCATGTGGCTAATGCCGGTGACATTCGCGCGGTG
TTGGGAAAGCTCGGCAAGGAGCCCGACACTATCGTCGCAGAACCACTGAGCAACGACCAGAACGCCATGGTGAAattcgagcaggagaagctaTTCAAAG
AGCACCCCGGTGAGGCGAATGCTTTTACGTGCCGCCACCCGGACTCGTGCTACGTGAAGGGTGCACTGCAGCCCACGCGTGCGTTCGGTGACTTCTCCCT
CAAACACCCGGAGTTTAACGGCCCACCATACAAGAACGGCGATCGATCGGCTGGTCGTCACTTTTCGGCACCTTACACTCCACCTTACATCACCGCTATC
CCGGAGGTTAAGTCGCACAAGCTCACGGACGGAGACAAGTTCCTCATCATTGGTTCGGATGGTTTATGGGACTACCTCAGCAacgaagaagcagtcgaaG
TGGTCAATGGCCAGGCTTCCTGTGGCAATCACGACCTTGCCGGGCGTGCACTTGTCGAACGCGTGCTTCAAAAGGCAGCGAAGCGCTACGGAATGACGTA
CCAGGAGCTACTGAGCCTACCGCCCGgaagccaccgccgccgtcgccacgATGACACGACGGTGATCGTTCTATTCTTCGACTAGAGTGAGTTGGGGCTA
CGTTTGCCTAGTAGCCTTGATGTATGCGAAGGAATGCACTATGGACAACAATAACGGCACAAAAATTGAGGGCTAACATACCTTTTTCAGGGCCAACTAA
CTGGGATTGCTATGCGTGTTACGAGGAGAGGAAGGCAATACGTTTCTGCTAGCAGATTGAGGTGGTATCGGTGTACCCGTAATCGTAAGCGGAGCTGTCG
AGGGGCTTGGAGCTACATTGCTCGCATTCTTGTTCAGTAGTTGCCGGTACGCGTCGTAGTTTTTCTCTAGCGAATCTGTGTagaactgcaacaacaaatA
CAGTGAGTACGACCTGAAATGCAAATTCTGCACAGCCCAGCACACGCAACATACCCGAAGGTGGTGGCAAAGCGAAGTCAAGGGCAACCAAATTGGGCGC
ACGACGTAGTTGATGAAGTTCAGGTGTACAGTGATCCGAACGCGCTTATTCTCCAGGTTCTGCATGAAGTAGTCCGTGGGGACACCATGTTCGGCTTCAG
CTGCGGCTTGATTCTGGAACTCGTCGAGTAAGCGAGCCCCCcattcttgagcttgaggaAACGGCAGCGCATAGTGCGATAAATCGGCAGCGTGCATCAG
GATCCCCATGAAGATAGGGCGTTTGTCTCCTAGCTGTCGACGTGTAAGACCCTCGAGGATCTTGCACTTCTCGAAGTGTTTCGACATGTCCGTCGCGAGA
ATACACGAAATGATAAGCTGTCGCACTCGTTTGTGGCGCTCCCGATCGAGATGCTGCAAGATCTTAGCGGACTTGTGGTTGAGAATGATGAACGTCACTC
GGCAGTGGTGGCGCTCTAACACGGCGTCATCGTTGTGCGTAAGAGCCATTGGGCTCAGCATCTTCAGTTCGAAGTCGTTGGTATTTCCCGGGTGGTCGAT
ATCGTGGCACAGGGAGGCAACCAACATGGCAAAAATTTCGAGGCCGCTGAAGTACCGGCGACACTCGGTACGTAGCATGATGTGCATGGCCACCATCACT
TGAAAACCGTGTTGAAAGTTGTGAAACGCGTTGCTACGATAGTAATTGGCCACATTCGTTGTAAAAGCCGAGAATTTCTCACTGGAAATCCGGAAAGCGT
CCATAAACCCATACGCGCGAAAGATAATCCCACAGCTCATACACACTTCGCTGCTCGAAAGCGACACCGTCTCGGTGTCCCAATGGTCCAGCGgttcatc
tcgtccatgagtGAAGAGAATTTCGCGTGGGAAGGGCACTACGTCGTCTTCGtgactcttcttcttgatggccGGCAGCAGAGCTGCAAAGGAGGGCACC
GCTTTTTTCTTGCTTACGCTGGCCTGATCATCACCCGAGTGGCAATACTTGTGTACAATAGATGAAATGATGTCGGTCTCGGAGAATTTGTCGATGCGGC
TTGTAGTTGACATCCGCTTCAACACTCTCGCACTCGCGTCTATACCAGTTCGTGATACAGCAACGCAGTCCGACACGACTTTGTAGTACGAGATGTCGAG
GGATAGTCGACCCAGCGCGAACTGCACTTCGGCACAGTACTTAGTCATGATTTCACGGTCCGTTTTggtgaaggcgacgacgTGAACACCTTCCTTCTTG
TTGATACAcatggcaacagcaactacCTTTGGAGGTATCGCGATCGAGTGATCTTCGAACACCGGCATGCAAAGAACACTTGTAGTTCGATACCCCGTCT
TCAAATCCACACTTgggtcgaagagctcgtgctTGTAGGCATCTCGAGTACACACAGTCTCGCCAGTAGTTGCTACAAGCCCTGAAATCCCGCGGTTGAT
GGGGGAACGGATACTCTCCCCGCCAACGCGAGGTGTGATCCAAAGTTCATGTTTGAAATGGTCGATAAGGAGGAGCCCAAAGCGATCACACTCCATGATA
TCCTTACCCAACTCCATGACCATGTTCACGAACTCGGCAATGTCGGTGCTTTCCGATATAAAAGTGGTGAGCCTCAGTCGCGCTTCGATGAGTTTCTGGG
ACGTCCTGACTTCGCGATGCAAGCTCGCTTTGTGGAGCGATGTACCCACGGCTTCGGCCGCGTAGTTGAGGAAAATAGCGTCCTCACTGGTGAAATCCAT
TCCGTCTACTTTGTTCACTGCAGAAAGCACCGCCAGAATGGTTCCTTCGGGAGACTTCACTGGTAAACACAAGATGCGTTTGGTAAGGAAACCAGTCTTT
TGATCCAATGTCGAGTCGAACAGCGGATGCGAGTAAGCATCATTCGTGATGACAGTCTCCCCCGTGCGAGCAACGTATCCTGCAATTCCTTTGGTGATTG
GCACGTACTCACCTCGAACAATATCAGCTGCGCTGGCGATGTAAAGttcgtcttcgccgtcaaTCTTGATGAACAAGCCAATACGCTCAGTGCCCACAAG
TTCGTGACAAACAGATAATACTTGGTCTAGTACTGCAGATGAAGACACGGTTTCCATCGAAATGTTACGGTGTAGCTTCAACAGTCCTTCGATGCGATGC
TGGGCAGTCTGTCGCTGGCGTGAAAGTACTAAATTCCAGATCGTAGCTCCTGCTACAACCGCGATAAACTCGAGATTCGCGATGTCTGTGTCCGTGAAGG
ATGGCGGCGTCAGAACTGCGTtgtctgttgctgcagagACAATTGACGGAGACTTGCTAGTTGCGACCACTTGCAGCACGCCGACTACAGCGTGATGAGC
GTTGCGAATGGGTAGGCACAGTAGAGCTTGAGGAGAACCCGCCCCAGCGTTGCCGCTTTTCCCTCGTTGACTTTGAAAAATCGCGTGTGTGTCAGAATCG
TTGATAGCAAAAGGTCTTCCAGTCATGATCACACGGCCGAATACAGTGGGGGAGTCAGGGATCACGAAGCCTTCGCTGATGACATCGACCTTCACAAAGG
ACAAATCGACGTCGGCGTCGGTCTCGTTGCGCAGAGTAGAGAACACGTCCAGGACGTTACGACGTTCATGCAGAATGCCTAACGTGAACTTGTCGGCACG
GACCAATTGCAGCGCCGCCCGCAATGTGCGCTCGATGACgctctcgaagctgctctggGCCGAGACCTCCTTCGCGAGGGTCATGAGCGTCTCTAGCTGC
GAAACCCGCTTCTGCATCGTCACAATACCACCTGAAGTACCCCCAAGTGTACTAGGAGATGCTATCGCTTGAGAGTTAACACCATCGCCTTTCTCGCCCG
TGCGGGATTCATTCacactgctgctgtgccCAATTGTGCTTTGCCGATGCTCCAGCAGTCTTGACTCCACAGTCACAGACCTGCTTTGAAGCATTTGCAC
GCGCTTGCGACTCTCTTCAATCCTAGCCAGCAGGCGTTGCTTCTCCGCCGCCTGCTCGCGAACGCCACACACGACTGTCTTCAGCGCGTCCACAGGAACG
AACACCATCTTACAGTTCTCCGTGGCAAGCATGATCGCGTCGGTGCAGGTAAT