Description :
From Genome Similarity Track
Location :
contig_4:205340- 206749
Transcript NameFunction/comments
g1231.t1hypothetical protein

Sequence
1409 bases(100 bases per row)
TTCTTCGTGATGAACTTGACACTAGCAGTCATTTCCGAGGAGTTCAATCTTGATCAGAAACCTGGAAAGACAGCGGCTCAGAAACGAGAAGACGAGAAAA
GGGCGAAGATTGAGAGAGAAAAGGCCGATAAAAGGGCTCGCGAACACTGGCTGAATGCTATTGTGTCTCATAAATTGTTTGCCGCGTTTATTATGGCTGT
GATTCTTGCAAACACAGCTATTTTAGCACTCGACCATTACCCAATGCCTACTCCATGGACGAAGATCTAGAAATTGTAAATTTCGCGCTCTCCTGTGTGT
TCGTCGTGGAGATGGTGATGAAACTATTTGGTCTTGGGTTACGCCAATACTCACGCGACAGGTTCAATTTGTTTGATGCATTCATCGTAACAATGGGAAT
ACTGGAGACTGTTGCATCCCCGCCATCGTTCATGTCGAATAATCCCCCTAAAAAGGGAGCAGTGTCAGCGTTGCGATCATTTCGGCTTTTTCGTGTCTTT
AAGCTCGCTCGAGACTGGAGATCGCTTCGTGAGCTCCTTGAAATGATCATTCGCGCTGTTGCGAGTATTGCAAACTTTGGCGTGCTTCTCTTCCTATTTA
TCTACATCTATGCCTTGGTGGGCGTCCAGGTAACCAGGCTGAGCAATGTTCTTCAGCAAAGGATGAATATTAGAACTAACTTGTGCGTTGTCCTGTTTAC
TGTAGTTCTTTGGCAACACCATGCGCTTTGATGATGAAGGCTATCCAACACCGTTCACACTAGAAGGGTTCTGGGCTGGAACCGTAAGGAATCATAATTT
GATTTTGTACGTAGCAATGACTAACAACTCTCAATCGTGACCAGGTTCCGCGAAACAATTTCGATACCTTGCTGTGGGCTGCTGTCACAGTCTTTCAAAT
TATTACCGGGGAGAATTGGAATAACATCATGTACTTCGCTATCCTCGGTAATGGCATGCTTTCGTGCATTTACTTCATCTCACTGGTAAGTACTTGCAGT
CCTGCTTCGTTCACTACTAGAACGCAGTCCCTAACCCATGTTTGGCTGTACAGGTGATCTTAGGTGATTTCGTGCTTATGAATCTGTTTCTGGCGCTGCT
ACTCGACAACTTCGGCGGCGATGGCGACGAAGAGCAGGCGATGGAAAAACAAGAAGAAACAAAAAAACTCGCCCAGAAGATGTCCGTCATGAGTATGAAA
GTTGTTCCCGTTACCTCAGAGAACGAGCGAACAACGACCACAAGAGGAAGTTTCTTGCTAGTATCGACAGCATTTTCGTTGGGGGTTCGCCGGCAATCTA
TACTTGAAATGGACGAGGAAGGGGATGAGGAAGATGTTCGAGTAGTCAACATGGAGAAGTTTGCAGACGAACTTACACCGAGTGTACCTCTGGCAAAAAC
GGTCTACAT