Description :
From Genome Similarity Track
Location :
contig_4:205339- 206748
Transcript NameFunction/comments
g1331.t1hypothetical protein

Sequence
1409 bases(100 bases per row)
TTCGCGTCATTCTTCGTGATGAACTTGACACTAGCAGTCATTTCCGAGGAGTTCAATCTTGATCAGAAACCTGGAAAGACAGCGGCTCAGAAACGAGAAG
ACGAGAAAAGGGCGAAGATTGAGAGAGAAAAGGCCGATAAAATGGCTCGCGAACACTGGCTGAATGCTATTGTGTCTCATAAATTGTTTGCCGCGTTTAT
TATGGCTGTGATTCTTGCAAACACAGCTATTTTAGCACTCGACCATTACCCAATGCCTACTCCATGGACGAAGATCTAGAAATTGTAAATTTCGCGCTCT
CCTGTGTGTTCGTCGTGGAGATGGTGATGAAATTATTTGGTCTTGGGTTACGCCAATACTCACGCGACAGGTTCAATTTGTTTGATGCATTCATCGTAAC
AATGGGAATACTGGAGACTGTTGCATCCCCGCCATCGTTCATGTCGAATAATCCCCCTAAAAAGGGAGCAGTGTCAGCGTTGCGATCATTTCGGCTTTTT
CGTGTCTTTAAGCTCGCTCGAGACTGGAGATCGCTTCGTGAGCTCCTTGAAATGATCATTCGCGCTGTTGCGAGTATTGCAAACTTTGGCGTGCTTCTCT
TCCTATTTATCTACATCTATGCCTTGGTGGGCGTCCAGGTAACCAGGCTGAGCAATGTTCTTCAGCAAAGGATGAATATTAGAACTAACTTGTGCGTTGT
CCTGTTTACTGTAGTTCTTTGGCAACACCATGCGCTTTGATGATGAAGGCTATCCAACACCGTTCACACTAGAAGGGTTCTGGGCTGGAACCGTAAGGAA
TCATAATTTGATTTTGTACGTAGCAATGACTAACAACTCTCAATCGTGACCAGGTTCCGCGAAACAATTTCGATACCTTGCTGTGGGCTGCTGTCACAGT
CTTTCAAATTATTACCGGGGAGAATTGGAATAACATCATGTACTTCGCTATCCTCGGTAATGGCATGCTTTCGTGCATTTACTTCATCTCACTGGTAAGT
ACTTGCAGTCCTGCTTCGTTCACTACTAGAACGCAGTCCCTAACCCATGTTTGGCTGTACAGGTGATCTTAGGTGATTTCGTGCTTATGAATCTGTTTCT
GGCGCTGCTACTCGACAACTTCGGCGGCGATGGCGACGAAGAGCAGGCGATGGAAAAACAAGAAGAAACAAAAAAACTCGCCCAGAAGATGTCCGTCATG
AGTATGAAAGTTGTTCCCGTTACCTCAGAGAACGAGCGAACAACGACCACAAGAGGAAGTTTCTTGCTAGTATCGACAGCATTTTCGTTGGGGGTTCGCC
GGCAATCTATACTTGAAATGGACGAGGAAGGGGATGAGGAAGATGTTCGAGTAGTCAACATGGAGAAGTTTGCAGACGAACTTACACCGAGTGTACCTCT
GGCAAAAAC