Description :
From Genome Similarity Track
Location :
Scaffold_105:205324- 208777
Transcript NameFunction/comments
Physo_141931hypothetical protein

Sequence
3453 bases(100 bases per row)
CAACCAGCGCGACACTAAATCCGCCCAATCGTTCTTAGAGCCCTTGACATGTTCGATTTCATAGCGGTAGTCCGACAGCATCAGGGCCCACCGCTGCAAC
TTTCCGCGCACATGCTTGCGAACCTCCGTGTGGGGGCAGAAGATCTGAATGAGATTCGCGTGGTCGCAAAATAATTTGAACCCTGCTTCGCGGTGCAGCA
GATACTCCAGGTCCTTCGCAGCCTTGATAATGGGATAGCCTTCCTTCTCTGCAATCGACCAGTGTAGCTTAGCACCCTTAAACATACCGCCCTTGCAGAT
TAAAAGCTCGTGCGACTGGTCGGTCAAGATCTTATGGTCATCCCAGCACTCCACTTGCGAGACAATGAGTGGCCATCCTCGGTCCGAGGCATCCGTAGTC
ACGCACACAGTAGCCGCCTCGCTAGGGAACGCCAGCTTCGTTGATCGAGCCACAGAGTCAAGGAACTCGCGATAGTGGTGCTTCTCCTCAGCCGTCCACG
TGAGCGCAAGTCCTTCAGCATAACGCTGCTTCCGACTGTGTTCTTCAAATGCACTCTCCAGTTTGGCTTGAAGTGGGGCCGCATGCTGGGCAAAGTTCAC
GATAGATTCACGCAACCAATTAGCTGCGCAAAGCAGCTTCTGCAAATCTGCCGCTGTGGCTGGAAGCGGCAGTGAACACAGAGCTGCAACTCGTTCGGGA
TCGTGGCGAACGCCCTCACCGTCAATGAGGCGTCCGCACCAGGAGATCTCACGCGCGAAGAGACAGCTCTTGTTGGCATTGAGCTTCAGACCATACTCGC
GGAGGCGAGCGAAGAATTTCTTGAGCACCGCGATGAACTCCTCCGCAGTCTTAGCGAACACGACGATATCGTCCACCCAGATCAGTACGTTTTCATACAC
CATATCGCGAAACACCTCCTGCATTTGGTTTTGGAAATGGATCGGCGAGTCGGTTGCTCCTTGTGGCATGTGTACACAGTGTCATTCGTGATGAAGCTGA
AATATTCACGGCAGTCCGGGTGCAGCAAAAGCTGCCAGAACCCCTTGAAGAGATCGAACGTTGCGAAGAAGCAAACCCTTAACCTTGGCAATCACCACCA
GTAGGTTTGGCATTGCACCTGCGATAGGCACGGTGCGCTTGTTGATCGGGCGGCAGTCGGGGGCGCACCGAAAGTCTTCGACGGGACCCTTCTTGCGAAC
GGGAATGGCCGCACAAGCCCACCTACTCTGATTGTTACGTACAACCAGCTCAAATTCTTCCAGCTGCCTGCCGTAGTCCCGAAGGAACTTGGGTTTCAGC
TCAGAGTACTGGCGAGGCTTCGTTCGATACGGTGTGGAGCCGTCGACCAATACGACTCGCAGTGGCTCGAGCTTGGCGGGTGGGTCCGCGCCTAGCTTCG
TCCGCCATAGATCAACTTCTTCCTTGGTGGCATCTCGCAGCGCATCCTTAAATTCGTGTGGAAACCTGGCCTTGACAGCGTCGTCCAACATTACGTCGAG
TCGGTCCATGATTTCATCCAGGTTGGTCGCGCCCACGATGTCATCCTCCGGTATACCATCCTCGTCCTCCTCGGGGCCACCTTTGGCTGCGAGGCGCTCC
AGGAGATGATCCACGTTGATCCCAAGCGACTTCAGAGTTCGATCACCAAGTAAGAACTCATCCGCATCTCCATCGATCACTACACACTGTAGTCTGCGCA
GATTGACCGGACTGGCAGCCGTTAATAGCTGCACGTCAACTTCACACATCTCGGTGCAAGGAACGAGCCGTCCGTCTGCCACTTTAACCTTCATCGGCAC
ATCCAGCTCTTCCACCACGAGGTCATCATCCAGTTTCCTCAGTTCATGCGTAATGTGGCGGGTAATCACGTCGTAGTCAGCGCCAGTGTCGGCTCGGAAA
GGCACCTCCAATATGCCATTCAAAATGGCTGCACGCTCGCCGGGCTGCCCTATTGATCGCACAGTCTTCACACGCAAGCGCTGGTTCTTCATGTCATTCA
TTCGTTTTAGGGCTGCTTCTTTGTCTGCCTCACTAGCGGTGGGGCAATCCTTCACCCAATGTGCTCCATTGCACACGAGACAGCCATCGCGCGGCGGTGC
GCGGGGCTTGTCGGCTTCTTGTTTCGACTGCTTGGGCTTGCTTGATGACGAGTGTTGGGGCTGTGAAACACGAGGCTTCAACGAAAGTGCTGGCTTCTTG
TTGGAGTGATTGGTCTTGGGGTTGCTACGAGGTTTATCCACCTGCTTGAGCTCCTGGGCCAGCATGTGGTAGTGCTGCTGCTCTCGTGCGCGCTCGACTA
AGGCCTCGTAGAGCGCAATATCGTCCTTCTTGAGCACCGGCTTGGCGATGACCAGGCGCTCCATCTCCAGCCTCAACATCTCTGGCGCAATGTTCTTTAG
CAGGTACTTGCAACGCAACTTCATGCGTTCGTCGTAATTCGGTTCATTTTCGCGTCCACTACCGAGGATTCCACCCAAACCATGGTCCTCCACAATCTTG
TCAAACAGCACGACGTAATTCACCACACGAGCTTCGGTGTCTTCGATCTTAAGGTCCATCTTCAGTTCTTCCTTGAAAAGCTGGTCCATGTCCGGGATGC
GGCTATTTTGCAGCGCTGAGCAACGCCGCGTGATCTCCAGGCCGAGATCTTCATCGGTCACGTCAGCCGCTCGCTTCTTCAGCACGAAGCGAGCCTGGTG
GTCCAGGATGCGCGGCTCGATCGAGTTGCGGATCGAGGTGACAACGTGCTCGTACTGCTCGCCAGTAACCGCGCAGCGATTGCGAATCTTGGCTTCGTAC
TGGCGGCGCTAGGAGATTAGGGGCGCCTGGTCCCAGGCACTCAGGCTCGGAGGCTGAACCACCTCGAACACTGGCTGCGGCACGGTCATCTCAACGTCTC
CGTCTGCGTCCGTGGCCATCTTGCTTGTCTAGGCTTTACGCCGTGCAGGTCGACTTGATGCTGTAGCGGTCGGCCCGCTTCTTCCTCTTGCCGCGGCTTC
TGGTTCGTCCAGAAAGTATACTTTGTGGTCACCAGTATGCAAAGGAAAGTAAAATGAATTCTGATGTTAGCTCCAACTCTAAACTAGTGCTTGTCCCTGC
TCCTGGCTTTTGCCTACGAATTCGTACAGCTTCTCGAATCCGGCTTCTAGAACTCTAAGCACCAGAGCGAGAATTGCTTCGGATCGTACAACATGCACTG
CGGCTGGCCACAGGTGGGGAAGTGAGCGTGGGAGCTTGTCGGTATTCGCCATGGCCTCAGCCAGGACGGGGACTGAGCTGTTGCCTTCAATAATGGACTT
ACCGTGGGTGTGCGTCGCGGCAACCGAAAGGCTAAGCGCAGAAGCACGCAGCAGCCAACGATCTACAGGATACAGTTGGTAGGTGANATAGACACTTTGA
GCGTAAAGTGGTGGCTGTTTCCCGCCAAGTTATCATCAATGGCATGCAGGACG