Description :
From Genome Similarity Track
Location :
Scaffold_93:20531- 22842
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_93-fgenesh-gene-0.3Aspartate aminotransferase

Sequence
2311 bases(100 bases per row)
GCGAAGATGCAGCTCGCGATCGCCGCCGTCTCGGGCGGCGGCATGTCGGTGCGCGAGGCCGCGCGCCGCTACGGCGTGCCGCGCACCACACTGCAGCGCA
AGCTCTCCAAGGACGCGACCGGCGGTCACAGCGGCTCGCGCAGCAACAGCGTCACGAGTCCCGGAGCAAGCGGCGGCGGTGCCGGCAGCGACCACAGTCC
GAGCCCGACGAGTAGCAACACGGACCACATGACGAGCGCGCGAGTGGCGCCAGCAATGGCGTCGTCAGCGACGACATCAAACTCGGTCGCAGCAGCGATC
TCGAGCGCGATCGACGCAAACCAGAGCACCATGAACACGATCCTCGGGCTCTACGAGAGCAACGGCAACGGCACGACGCCCGTGGCGTTCAGCAGCTCCA
TGAGTCGCAAACGGCCCGCCGAGGCCATGAACACACCCGACAAGCAGCAGCCGATCCGCAAAGGTACACACGCCACCAATGCTTTGTCGTAAGCGCTAGG
CTGTTTTTCTGACTCGTGTTCTTATTTAATTTGCGCATTTGAAGGACCACACAAAGCGATTAACTGCAAGGTCCGGATGCTCTGCACGTCGGCAGGAAGC
GCGCTCGACGAGCTCAGTAATGAGATGATCATGGAGGGCAAGTGCATCTACAAGCTCGGCCTGGGCCAGTCGCCCTTCCCGATCCCTCAGTGCGTCGTTG
ACGAGCTCAGGTATGATTTTTTGCTAATTTTTTTTACTGAGCTGCTTGAATTCCACGGTGTTCTATGGTGTCCAAAGAGCCAAATTGGAATATGATATCT
GACTTTATTTTTATGTATTATTTTTTTAGAGCAAACTCGCACCAGCGCGAGTACCTCCCCGCCGCAGGGCTGCCGGAGCTATGTGATGACATTGCCGCAT
GGGGCACCAAGACGCTCCACATGAAATACACACGGGACGACGTGCTCGTGGGGCCAGGCACGAAGGAGCTGCTCTTCGTGTTACAGACAGTGTACTACGG
CGACCTGTTGCTGCCAAACCCGAGCTGCACGAGCTACGCTCCCCAGGCAAGCATCGCTGGCAGGTGAGAAAGGATTGCTTGTTTCGTACGCAGAGGCCTC
GTCTCGCCATATAGAAGGGCGGCAGTGGCTCATCTATGGTCATGTGCTGAATAGTGTGCCCGCGTTTGCAAATGTTAGGAACATGATTTGGCTCCAGACC
AACGCCAAGGACCGGTGGGTCTTGCGGCCCGAGGTACTCGAGGACCACTGCGCCAAGGACCCGGACGCGCCTCGCATCATGATTCTCAACAGCCCGTCGA
ACCCAACGGGCTGCGTGTACAGCGAAGAAGAGGTGCGTGCGGATATCTCTTGGGCAATGCTGAGCTGTCGTCCATTTAACGTGGATTTTTTTATTCATTC
CTCTACAGTTGATTGCCGTGGCCCAGGTCGCGCGAAAGTACCGCGTGCTCGTGATCTCGGACGAGATCTACTCGGAGCTGTACCACTCGGGCGAGCACAT
GTCCATCTCCAAGTATTACCCCGAGGGCACGATCGTCTCGGGCGGCCTGAGCAAGTGGTGCGGCGCCGGCGGTTGGCGCATGGGCTTCTGGATGTTCCCG
GCGAGCATGAACTGGCTGCGCAAGAGCATGCTCGTCATGGCCTCGGAGACATACACGTCCGTCGCGTCGCCCATCCAGCACGCTGCACGGCGAGCCTTCG
TACCAGAGTAAGTATTATTGTTATTTCATCCATGCTTGAAGATATGTGTGCCCTCTTCGGTACGATCTCACCCAACATTTATTATTTATTGATTTTGTAG
CTGCATTGAACTGGCAGCTTACAAGGACAAGTGTCGGAAGACACTGCAGATCATCGGCCAGTGGTGCGCGTACCAGATGCAAAAGATGAACCTCGACGTG
CAGCTCCCGTGTGGGGGCTTCACGATGTTCCCGAGCTTTGCGCGCCACCGCCGCGCACTCGCGCTGCGAGGCATTACGACGGATGTGCAGCTCTGCGCCC
AGCTGCTGCACGACACGGGGGTCGCGATCCTCCCAGGCTCGTGCTTCGGCCGCTCGCCCGACGAACTCTACGTGCGCATCGCGTTTGTGGACTTTAAGGG
CGAGATCGCGCTGTACCTGATCGAGACCATGGTGAGTGTGTATCTTTCTGTGGTGGACATTTTTGGATGTCGTCTGTTGGGCATGGGCACTGACAATTTT
TATATGTGCGTCACCGAATAGGACGACCTGGCACTGGACGCGATTGACGGGTTCATCCAGTCCGTGTGCCCGAATCTCGACATTGCCATGCGCAAACTGG
CCAACTGGGTG