Description :
From Genome Similarity Track
Location :
contig_30:205301- 226457
Transcript NameFunction/comments
g5308.t1hypothetical protein
g5309.t1hypothetical protein PHYSODRAFT_362533
g5310.t1hypothetical protein PHYSODRAFT_532795
g5311.t1hypothetical protein
g5312.t1hypothetical protein

Sequence
21156 bases(100 bases per row)
GGGGCCGGGGCGCATGAAGTGCCCATGTGCGGCGCGACCATCCAAATGGCCTCCCGTCAGAAAAGGGAGCTTGAAGGCTTCGTGCACAGGCGGTGTAAGG
CGGTGTTTTCCTCCCAGAACAAGAGCGCGGCCACGGGGATGGATGCCCGCGCGCGTGTTAATCCGAGTGGTGGCACCGCGAGCGGCGAGCGTTGTGCGGC
CGACCTCGAGCGAGCCCGCTCAGCGAGCCAGGCGCCACTACGGTACCGTACGAAAGCTCGGTCCGCCCCGCGCATGGTCGGAAGCCCTTCTCTTGCATAG
CGGAGACCGTCCTGTTCGTCACCACGATCGCCTTCCACACCGGAAGGACGTGCTTGGAGCTGTTGCCGGGCAGCACGACGAAGCGAGCGATTGAGCGCCA
TTGCCACGGCCGCAGCGCGTGCTCTCTACGTGTATTGCCGCCGCCGTTGACGGTCCAGCGGATCCCCGCTCGGATCCTGCGAGCCCCACCCACCACAGCG
TCGACGAGCTGCTGATGTCATCGGTCCTGCTTTGCAATCGTGCTGCCTGTCCGGAAAACCAACTGCGGCGCAGAGGCCCGACGCGCGCTATGCGATACGC
TAAGAGCCGGGCCGCAACGATCAAGTTGGGAACGGCAGCAGCCAGATGCTGTTGCCGCCGGAGCTCACCACGCCTTGATGACTCGGAGTGCGGGTCGAAG
GCATGGGCGCCGTAGCTCACGATACTCACGCGGCAGCAGGCTACTTGCCAACTTGCAGCGGTGCAACGGCCAGCGACCACGGTCACCTCGCCGCCGCGGA
CTTGTAGGGCCATCGCGTTGGCTCTTCTTTCCGCTACATTGTACATGGAGGCAAGCCTGCATTCCTGAAGTGTAAGGAAGGGCTTTTCCTGCCACGCGCG
ACCTGCCTGCACGCTGCCACGCCTCCGCCGTCGTGTATGAAATGTGCCGCGCGCGATCTGGCCATAACACCTTTGCATTGACGAATGCCGTTTTATCGGC
CGTGGCGAGAAGGGCCACGAGGACACCGCCCCGAAATGGACACCAAAGGCAACACCGCGCCAATGCTAGCAACAATGCTGCCACCGCGCTGCTCATGCAA
TACAGCACACAGTGTTGAAGCGTGGCGGTGAGGGCGTCCAAACGCGCTCGACGGACGGCGGCGCACATCGTGCTGGAGCGCCGCTGTCTGTTATCACGGC
ACGGCGTTCACATCGGCCAGGAGCAGATCCAGTCGCGCTGTAATTGCCTTTGCGCGCGACCAGGCGCTTGCCTTTGCGGCCTCGTTAAAAGCCCTTTCGC
GTGCACGTGCCGGGCCGGTACGTAGATATTTGAATTCCGCCAATGGGCGGCGCGCTGCTCCGCGGGAACGCGCAGGATTGGTTCATCCTGCCTGCTCTCT
TATCACGGCATCCGACCAGAAAAAGAGCCTGAGATGGGCATGGGACACGCGAAGGGATCGGGGTGCAGAAACCAGTGCGACAGTTGTGCCTTTGCGACCG
CATCGCCCGCCCGTGATTAGACGGCCGACGGCGCGGATGGCGGTGAAGGCGCCGCCAATGTGGTGCCGGCGCAGATGAAGGCGTTGTTGTGGGCTTGCCT
GTCTCTGAGTCCGGCCGGACCCGTCACATCAACTCGACGCGTGCCCCGAAAAAACGGGATGCAAGTTGGGGCAAACACAACTGGACGCGATTCAATCTTT
TTGAACCGAAGATGCTCCCCTAACCACGCGGCTGCCCCTTCTTTCCCGCCGCGCATGACCGGGCGTCTTGTCCATCCGCAAAAGGGGGAGCCCCGAGTGA
GTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTACTCGCTTCGTCTTCGTCTTCGCGGTGCCCGTCTCCGCCAAGGGCCAAGTATTT
TTTCTGCCGGAGCCGACGCAGTTAGTTTTATGGCCTCCACGTCCTCGTCCTCGGCGTCCCAGTCCACCAGCAGCAGCTCCAGCACCCGAGCCATGCAGCC
GCAAGATCCCAACCCCGCCGCGCTCGACGCCTCGGCCGCACAAGCCTTCAACTACGACCCGTCCTACCAGCAGTACGCGCAGGAGCGCGCGCTGCACGAC
CAGGCCGTGCACAACTCCATGGCCGCTGTGAGCGGCTCCGCCAAGCCCGCAGGCGCGTCCAAGGAGTCCGTCGTCAAGACCAATGACCCCTCGTCCGCCA
GCGCGTCCCCCACCAGCGTGACCAAGGGGGCCCCCGGCTCGACCTCGTCCACGACCAGCGCGTCCTCCTCCACGGCCGCCAAGACCGCGGGCGCCCCGGC
CCGCAACGAGTCGCTCAAGTCCAACCGCCTCTGCACGATGCCCGGCTGCACCAAGCGCGTGCGCTCCAAGGGCTTGTGCAAGGCCCACGGAGGCGGCCGT
CGCTGCATGGTCGACGGCTGTGAGCGCAGCAGTCAGGGGCAGGGCCTTTGCATCCGCCACGGCGGCGGCAAGCGCTGCACGCAGCCAGGCTGCACCAAGG
CTTCCCAGTCCAACGGCCTCTGCAAGGCCCACGGCGGCGGCTTACGCTGTCAGAGCCCCGGCTGTACGAAGAGCAGCCAGGGAGGAGGCTTCTGCCGCGC
CCATGGCGGCGGTCAACGTTGCGAGAAGGAAGGATGCAACAAAGGCGCCCAGCGCGGCGGCTTCTGCGCTGGTCACGGCGGCAGTCGCTTCTGCCAGCAC
CCGGACTGCACCAAAAACGACCGTGGGGGAGGTTTCTGCGCGGACACGGCGGCGGCAAGCGCTGCGACCACCCGGGCTGCAACAAGCCCGCCCGCAAGAA
AGGCAAATGCTCGTACCACGCCAATGCTGCCAAGGGCAAGCTGCCCAAGGACCAACTCGCCACGGCTGGAGTGGCCGCAGCTTCGTTGCCGCAGCACATG
ATGGATATGCGACAGATTACCACGCCGACGTTCGCGATGGGTGTCAAGGATTTGCGTGGGGACCAAATTGACGCGCAGCGCGCCAGCTACGTGCAGCAGC
AGCGAGCGGAGATGGACATGCGCTACAAGAGCTACGAGGCGCAAACCAACGCCGGCCAGTACCTGCAGATCCACGCCGACCAGCGATCGTATGAGCCCAT
CAGTTTGCAGGCTGGTGGCGCCCAGCGCCACTACATGCCGGTGGACAACGGATCTCTGCCTCCGGTGTCTGGCAGCATGTACAAGCCATCAGACCGTCAG
GCGTACGCCTCGCGTGCCCCAGAGCAGATGAAGAACCCGTACTCGCAGCACTGGGCCGCCAAGCCAGAGATCCCACAGCACCACCCGGATGGACGGGTTG
ACTATTTCGATGTGAACAAGGAGCAGCAGCAACAGCAGCCGCCTGGACACCACCTGCCTTACTCGGCTCAGTCCGCACAGTACCACCACCACCTGAGCGC
CGCTGACTCGGCTGCCGCTGCTGCAGCCTATGGCCAGCAACCGCCTGCTCAGCGTGCATACTATAGCCAGCAGCCCCCGCAAGCTCCCGCATCCGGTGAC
CAGCCAGCGCCCCAGCAACAGCAGCAGCCCAACATGATGTACTATTCGGCGAACGGGTACCCGCAGCACCAGATGCACAGCATGCAGCAACAGCAGCAGC
AGCAACAGCAGATGCAGATGTTATAAGTCCGGCAATGCCACCGTGCAGTCGCTGAACGGGTCTGCTCCTTGCACGTCGCGCAATATGAGACGAAGCTGAC
GAATTGAGTGCAAGACGGCTGTGAGGTGACTGCACGCTGTAATAGAGATAGAATCAACCCGCCATGGATCGGAGCTCCTCGAACTCGAGGAAGCGGCAGA
AGTGTTTCGTGCCGTCGGATAGGGAACGTAGCCTTCCTCCCTACCAGTTTTGACCAAGCTAAAGGAAGGATCGAGCGAGAAAAAGCATTTATCCACTTCA
ACACGTCCGTATTCAAATGTTATCTGTAACTGCGGGGCGAGCCCATGTACAGCGGCACCGCCGACATCTTGGTCTCTTTTGAGTGCAGAAGCCTGTCAGA
AACATCACCTCGCCCTTCTCTTGCTTGTACAAGCCCGGACTCTTTCGGTGTGTGTCCGCCAGAGATCGAGCAGCGCAGGCCAAAGGCTGCACGCAAGAAG
CTTCACATGGTATGTACAGGACGGAGTTCACATTTGCTTCGGTTTGCTAGCTCTAATAGTCTGGTCCTACACTGAATTGGGACGGCGTGGAGGCCCGTCG
AGCCAGCACCGCAGCCTCGTCCTCGTCGTCTTCGTTGTTGCCGAGCTCCCCAGCGTCGTGCTGCAGTCTGGCTGCAAAGCTGGTGGCCCGTCGTCGGGCG
CTACGGCCGCGGGGCGTCTTCTACTTGGACTATCTATTGACACGGCGGCGGTGGGGCCCCGCACGTCCTCGAGCTTGGCGTTGCGGGCCGCGCCTCCCCG
TCTCGACTGCAGTTTGGCCTGCAGGTACGTGCCGATGGCCGACGTTGGCAGATGCAGCGGCCCGGGGGACGACACGCGGGGTGAGCCAGCCTCCTGGCTG
TCGTCCAGAGCCACGCGGAAGCTACCCTTGCCCGCATAATAGTGGCGATAGCACTCGATGAGTTCGTGCTCCATGCCCGCGTACGTCTCCAGTAGCTGCG
CGGCTGAGGCCTCATTGCCCGGCTCGTAGACGTGCAGCAGACGCTCCAGCTCCGCCTTGTAGGTGGCCGCGTCTTGCTGGTTGTCGCGCCGGGGACTGCT
CTCGAGAGGGCTCTGCGGACGCATGAAAAAGAAGCTGCGGCGGATCGGGCGAAAAACGTAAAATGGCTCTTGGATGCCTCTTTGTGCGGTGCACAGTTCT
ATATTTTGATTTTTCCATCGACTTTAGCTTCAACCAGCTCCCAATGGGGAGCCATCGGCCACATGGGCTTCAGTCGCAGTTGGAGCTGCTCGACTGGCAG
TCTTTTTCAATGAGTGGCATCCGCTCGATTTGCTACAAGATCAGCCTTGATGCTCACGACTGCAGGGCCTGGGCGTCGCGCAGCAGTGTCTGGAAGCACT
GGATCAGAGTGGCGATGCCTGTTCGCAGCCCTTCGTCCCGCTTGGGAGACGCGTGCTGGGTCGCGTGGGCAAAGTCGATGAGGCGGATGTCAGCTGCGTA
GGGCTCCGACCCGGTGTCGCTGCCTTTGACAGACGCCCCGCCGTCGTACAGGAAGAGGAAGGAACTGGCGATGAACTCCGTTCCTTGCTGCTCATCGAAC
CACGTCTTGAACTGGTCGAGGCGACGCAGAAACTGAAAGGCAGACAGCAGTCGATACCAGATACGAAGAGCGTCAGTTGCGAGTCTATCACAAGAAACAG
CACTGCAGTAGCCTTACAGCTTCCAGCAGTTGAATAGTCTTGGGCGTATCTTCTGGCGGGAAGTAGTTGCGGAAGGCCGGTGCAAGCTCGTCCACAGAGG
TGATGCTGCGACCAAAGTGCTTGTCGAACTCGACATACCGCCGCTGCTTCGGGTCAAACATCTTGATCCCTTGAATACGGAAGCCCGCCGTCTCCTGCAG
CGGGAACTTGGACTTTTCGTACGCGATCTTCTCGGCCGTCGCGTCCTCTTCGTAGGACCGGGTGCCCATCTTGACGTCCATAATGCTCGGCCACTGCCTC
CCCCACGTCAAGTCTTCCAGAGCTAAATACTCTGCACCCAGCCACGATACCCAACAGCAAATTAGTACACTTCTAGAGCCCAAAGTTCCTCAACTTGATC
AACTTTTGCCCACGTCCAGGGTGCAGTCCATTGATAGGCGTCTCCTCCTCGCCGTCCTGCACTTCAGGGACCTCCACGGTGCCATAATAACCGGGTAGAA
ACTGCATGAGACTTGCAAACTCAGGCGAATCCTTCTCCGACACGAACACGCGCTCGTAGAAGCCGTGCTCGCGCTGTCCACGCTGTTTACTCTGGAAAGG
CTTCAAGATGCGGCCGTTGTGAGCCTTCAGGCCTGCCACAGAGAGCGCAAAGGCGACGATATTTACACCATTAGAATACCAGAAAAATATTCATTAACTA
AGACTATCGCTGGGTACTTTACTCGTGTTGGACGTGGCGTGGCCGCCCACTTGGTGTGCCATCTCCACGAAGCATTTGGTGTCCGCCATGCTGTGCCTTC
AAATGTGATATAGTCCGTAAAGATCCCAGCTCTGATTTGCAGCACCCTATTTTGTGACGAGAATGGCGCGCGTGCTGGTGCTGGGCGGCACAAGCTACGT
GGCACAGTTCTTGCTGCAGAGGCTACTGCAGAGCGAGTCGCTCCGTGTAGCTGACGGAGATGTATTGGGTGACATATCTGCAGTGGCATGCACAATGCGC
AGTCAGCCATTCTCGCCACTCCCCAATGGGTTTGTGACGGAATCGGATTCTGCAGCGCAGTCGACGCGGACTGTGCGCGTGTACTGGCAGGTGGACATCC
TGGACTTGGGAGCACTGGGAAATTGCATCAAAGAGTTCCACCCGACCGTCGTGATCAATTGCACAGGTAAACTAGTACTGGAGCTTGGTGAATGATATTT
TAAATGCTGATCTTTGCTGGCTGTGTGTCGCGCAGCGATTTCATCGCCTGCACTTTGCCAGAAGGACTCGGAGAAGGCACACGCTATCAACGAGGTGCTT
TGAGCTGGCTTTTTTTTACGGACGGCGCCTCTCTTGACATTACTTGTGTTGATAGCCTCGGGAGCTTGTTACTTTACTGGACCACCTTCCGTGGCGAATT
CGATTCGTGCACTTGTCAACGGACTTTGTTTACGATGGAAGGCAACCGTGGGGTGAAGGCTACGACGAAGACGCTGCAGTGTTGTCATCGGAGTTGTCAG
TGTACGGTGCTGACAAACTTCGTTCGACCAACACTGATGGAGCAGAGCTCGGCAAACTTGCAAGTGTTGATTCTTCGTATCGCAAATGTGGTTGGCTCGG
CAGCTCCATTGTTCCCCGATAGAAGCGCACCAAAGTTCATGGAATGGCTGCATCACCAGCTCTTTCAGTCCGGAAACTGCTACTGTGCCACTGAAGTTGT
GGCGTGACGAGTTTCGCTCTTACCTTTATATTCAGGACTTTGTCGCGATCCTCTTCAAGATGCTGTCGGCTCAGGCTGAGACGCCCGCTACTCTTGTCAA
CGTCGGTGCGTTCGCTCTATTCGATGAACTTTCGCTTTACAAGACTTGCTAACGTTCGTGCAGGTGGTGTGGAGGCACTTTCACGTGTGGAACTCGCGCA
CAAGTATCTTGCTGCTTCACAAGGTACAATTCGAAAGCGGTGAATGCAGTAAAGAGAGAGATCGTGCCGACCGCGCGAGCACAAGTCGACTTGGGGTACC
CTTCTCCGCTCAACACGAAGCTCAGCACAGCACGGCTCGCGCACCTACTGCCAACCTTCGCCAGGACATCGACGGATCAATTCCTGGACGAGATTAGCCA
CAGCTTTCTTGCTTGAAAAGGGAACGCTGCAATGTTATATGCTCAAGCTAACGATGGGGTAAAGAAAAAGATGACCAGAACGATGCCATCAAGTAGTCGC
CATACCTACATACGAAAACGCGCCCCACTCGCGCAGGTGATAGAGTCATCCAGTTACTGGATCTCCATCACGTTTCCCATGCTCTGCCGCCCTTTCTCGA
AAGCTTGCACGATTGGATCCTCATTGTTGCCCTTGCTGCCAGACGTTGACGTGTAGACGAAGTCCGCGTCACATAGGGCAATCGCGTTACACGCTTGGCT
GGGGCTCTTTCCCTTGCGCATGAGCGACACCAGCTCATCGAACTTGGAGGAAAGCACGTCGCAACGCGCACGGGGTGGTAGAACCGTGCATATGGTTTCG
AGTGTCATCTTCGCTTCACGCAAAGCCTTCTCATTGTCCTTGGCGCGCTCCAAAAGATCGGCAGTGTACTCGCAGAATAAGCAGCCCACCGACATCGACT
TCTCCGCAGGCACCTCCTCCACCGCTGCAGGACCACACGCTGCGATTCGCGTGCAGATGGTCTCCACATCTTCGTTATTTTTCAGTGAATCAACGATCAT
GTCCTGGTGCTTCATCAGTAGCTCGCACTATTAACGGACAAACACAATTGTTGTCAGGCGCATTGCAACGCAACATATGAAAGGGGCGACTTCTTACCTC
GCTGGAATCTGGGATCAAGCGACACACCGAGTTGATTTCGCGTTCGAATGTTGCCAAGCTGTTAGGACGAGTAATCAAGGACGCAAGCAGCAACGTATTC
TGCTGACACGATGCACACCTCGAGGGCAAGAAGTCCGAGCCCTTAAAGTCAAGCAGGCCCGACACCAGCGAACTGGTACCTTGAGTTGCCGTGCAAAACT
TAAGTGTCTGGCAAATTTCTTGCGGCTCCTTTCCAGCTTGTAAATCGGTCACTGCCTCGTCGAACATCTTAAGGTCATCGTGGCACTGTCATTTAAGCAA
ACAATATATCAGTATCATCTCACATAGTTGTACAGAAGACTTCGCTGTTCTGCATACTTACCGTGTCGTCGGCAGGGAGAAGTTCGCAAACGATGCCTGC
AGCCTCTCGCATTTCCTTCACTTGCTCCGGCTTCTGGTCAAGTGCGTACTTGAGCACAGTGACAATGCACTGCAGTAGGCACATGTGTTGCTTTCCTCGT
CGTTGTCTCGAACGGCGATCATGTCAACTGAAGGCATTGCAAGCTTGGCCATAGCAGGGTTGGTGTCCACCGTGCAATACTTCAGGTCGTGGCAAATAGC
CTTGGGCTGTTCGCCCTTCTGCAGAGAATCGACCACAGCATCGAACTGCTTTACAAAGGAGTGGCACTGTAAACACATACATAGAAAAATTAGCAACCTC
CTCGATGCATGTCAGTTGAGGCAAGTATCGTACCTGGTTGTCGCTCGGAAGCATTCCGCAAACAACGTCAGCGATTTGGCGAATCTGCGCGATCTTACTC
GGGTCTTGAGCCACGGCCACCTCAATGATGGACGCCACTTGCGTGCAGAAAAAACATCCATCAACCGACACTTCCATCGATTCCTTCATCATTTGGACCA
ACACCGGATCGTAAGCCGACAAGCTGCTGGGTGAAGAGGCCGGGGAAGGCAACGTGTTGTTTGCCGGGCAATAGTTCATCGATACACAAATAGCGTGCGG
GTGCGTCCCGTTCTTCAGCGAATCCAGCACAAAATCAAGCTTTGCAATGTACTTGTGGCATCCACACTCCTCGCCCATCAGCGCACAAGCAGTGTCCGCC
AACTGCTTGATTTGACCGATCTTTGTGGCATCTTGTTCATAAGCAGCTTGCACAAGAGTAGTCGCATAGTCACAGAAGAAACACGTCTTCGTGTCACCCT
CAACAGCATCAGGGCGACTCGCGACAATCAGAGCCGACACAGTGTCAGCAAAGGAATACTCGTCAGCGACCACGTCCACTTGCTTCTTACAGAGTCCGAT
GGTCTTGCAAATCTCGTGCGGGCGTTTTCCCTCCTTCTCGAGTTCCACGATCTTGTCAAAGTTCTTATCCACTTCATCGCACTTACAGTCAGGCTTTGCC
AGCTTGCACACGTTCGTCAAAATGGTCTTGACGATCGGCAGCTTTCCCGGGTCAGTCTGATTGACGTGGTGAATGGCAATACCAACATGAATGCAGAAGG
AACACCCATGGTTGTGTGGCGGGTGTTCTTCTGAGCTCAAGACCACCGCATTTCTTCACTGTCAGCGAGAGCTGGCTGTTTATCCATCGCCGCAGTGCAA
AACTTCAACTCCGTGCAAATTGCCTTGGAGCTCATACCCTTGGTGATCGAATCAATGACAAAGTCGAACTCCTTCACGTACACGTGGCACGGGTTGTCTG
CACCGAGCATATCACAGATCATGTCTGCGTACGCGCGGATTTGGCTGATATCGGTACCATACTGTTGAAGGGCAATTTTAGCGACAGTGGTGGCGAATTG
GCAGTATGTGCACTCTGTGGCGTTTCCAGGGGGCCACTGTGAAGCTACCACCACACCCTTCATCTCGTCCGCAATCGAAGGCGCACCTTCCTCCCAGCCT
CGTGTCTTGTTGCAAACCCAAGTGACTTGCAGATCTCATGCGGATGCTTGCCCTGTTTTTCCAGTTCCACAATCTTGTCGAAGTCTTGTCCACAACATCA
CACTTGCAGGTTGAAGGCACCAGTTGACACACGTGGTTAGATGGTCTTCACGATCGGCAACTTTTCAGGAGACGTGTGGTTGACATGGTGAATCACCATC
GCCACCCGTGAGCAGAAGAAACAACTGCCATGGGGTGCGGGCGGGGATGAGGAGGGTGCGGTGGGTGCTCGTCATGTGGGATGACTCCCATCTTATCACG
CTTGCCATGACCGTGGTGGCCGTGGCGGCCTCCAGGCCCCTCCATGCCAACATGCGCATGATGTCCATGTCGGCCATTTCGCATCATTCCGACACGAGGG
CTTTCGTCCAGAAGTGGAGGGCCATCCATGCGTTCAGCAGAGCAGTATTTCAGCGCCTTGCAAATTTCGCGAGGGTGCACTCCCTTCTTTAAGGAGTCAA
CGACCGTGTCCAACTGGTTGACATACTCGTGGCACGGGCTATCATCTCCCAGCATACCGCAGATCATGTCTGCGTACTCGCGAATTTGATCAATCTGGTC
AGGTTGCTCTTGCATAATAACCTCCACAACCGTTGTAGCTGCGTCGCAGTACACACACGTTTTATCATCTCCATGCACCCGATCCGATGGCGGCATATCA
TGCATGTTTTTTTGGGCAGAAATCGGCTGCTTGACAAATCTCGCGCGGGTGCTGGTCTTGCTGCACTAGCTCGACAATGTAGTCAAAGTTAGCCTCCACT
TCCTGACACTTGGCGTCCTCGGAAGCTAATTGGCACACGCTTCCAAGGACTGACTTCAGCATCGGGAGTTGTTCAGGAAATAGGCTGTTCACCTGGTAGA
TTACTCCGGCCACACGAGAGCAAAAGAAGCACGACTGGTCCTTCTCCAGGAATTCGGGGGGTTAGAGCGCCATCTCCGATTGTTTCGAGCTCTTCCGGAT
ACGCTGGAACATCGGAGATCTGACTGTCACTGCCACTGTCGGGCGAGCACATGGCGATCCGAGTGCACACCACGAGCGGGTCCGTGCCGTGCTTGAGCCA
GTCCACGATAGCGTCGAAATTCTTCAGGAACGTGTGGCACATGGAGTCTGTCGACATGGCGTCGCACAGGTCTCCAATGATAACTCGGACCTGCTGCACC
TGCTGCACTTCCTGGCTCAGCGCCTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGCACGACAAGTTGTCGGCTCCTTCCAAGTCTTCGACTGTGG
CCATGATGTCACACACCTCATCGTCCGTCTTGCCCTCCTGCAAGAACTCCTTTACCACTTCTTCCGAGCTCAACACACGGTTGCACTGTAAACAAAACAA
CATACCAACATCAATTTCCCCTCCCACTTCATCAATGAAACTGCATCCCGCACCTCTTCCACCAGCTCGGAACGCTCGAGATCATCGCACGAAGCCGCCC
CCCACAGCTGCAGCGACACCACGTCTAAGGCCGAGCGAAAGTACTTCGCGAGCGTCTCCGTCTGCTGCTGCAGCTCGTCCTGCTCGTGGATCTTCTCCAG
CGCCTTCAAGCACGCCGTCTTGCGTGGATCCTCCTCCTCCGCTTCAATGATCACGATGACGTCAGCCTCCTGGGGTTCCCCGAGGCTGAAGAATTGCTGC
AGCATCTCGCTGGAGCGCTGGAAATGCTCGTTCAGCACCGCCATGAGGCCGGCGGTTTCTTCCTCCTCCTGGTCGTGATGGCAGGGCATTTCGGCGTCCT
GGCGGTGGCCCAGGCCTGGGCGCCCGCCGTGGTCGGCACTTGCGACGGCCGCAGCGGCCGCCAGACTCGGCAGCAGCGCGTACACGGGGCGCATGGTTTC
TCGCTTCCCTCGACTTGTTCTTCAAGCTGGGTCGAATCCTGTTTGAAGCGGGGCGTGTGACTCCAGAGGAAGAGGACGGATGGCATGGCGAGGTAGGAGT
CCGCCTTCCACCACCAGTCGAATCAATAGTGAGATGGAGAGAAGATGGTTTTGTGTGTGCCACATTGGTACCGCCGTTGAATAGTAAAAGGCTCAGGATC
AGGTGGAAGGAGGAGAGGTCGACATAAGGTACTTGTCGCAGAAGGAATGCTGGTTGAAGTGGCCAGCCAATCGGCTGCATTTGCACCAAAGCGGATTTCA
ACGTAACTTGTACCATTTCAGACATTTCCTCTATACTTTTCTATCGGCGCTGTTCCTGAGGCTGAGAACTAACTCACGTTCAACATCGCAGTGAGCTGCA
AGCTGCCGCTTTGCGTCGAGCGAGGCACCCACAGCAACAGCGAACCACCTCCCGTTCCGGGAAGACGTAGGATACCCGGACGCCATCGATCCAGATACAG
CGTCTTACCTCCCAGTTCCGCTACACTCGACGTCCATACCACAGTTCCACCTGCCGAGACGGCCACCTTGTCGAACTTGTTGCCACCAGAGTGGATATTC
ACAGTCACATCCTCAGTGTCAACACTTTGAAACGTGATGGTGACAGTGCCATCGCCGACCTTGGTCCAGTTGCCAGAACTGTTGGCGAAGGCGTCCCCGA
CCATCCTGAGACCTAGTGCGTCGTTTTGCACTTCCATCGTCGATTTCGCCGGTGAATTTGGTCGGTCCACAAATGGTCTGAAAGTACTCGGAAATCACAC
TGTCGATATTTGTTAGATCCCAAACAGCGTAGAAAGTAAGCGCCTTGTCAGCGATCTTGTAGGCATATTTCTCTGCAGTGAGAAGCGTTCCGTTGGGGCT
GGTGCCTGAGCGGATTAGGTCGTCCATGATGCCCCAAAACTCTTGCGCAGCGTGTCTCGCGTTGCATAAGCAGCATCCTCGTCCGACTGCTCAATCAGCT
CTTCCATGCAGTTGTTGGTGACGATGGGGATCTCGGTAAGCACGAGGGTTGACTGGCTCATGGCCACACGAATATCGGCCTCGGAAATCTCCGGGTCTTT
CCTACGCAGGTCTGCCACATTCATCCAGGTGCGGTCCAGCAGGCGTTCATGTTATACCCGCAGGTGGAGTTAGACTCCAATGCTGACTGCAGTGAAGTGA
TGTCGGACTCGTCTAACGAATCCAGCGGCTTGTCTAACGCGATTCTCTTCATGAATATTGTAAACGCTGCCCAACTGGCAACGATCGCACCCTTGTCGCT
CACAATTTCTTTCACGAAAAGCTCAATCGTGTTGGTCACTCTGTCGGTTGTCTTGATACTCTCCGACACGTGCATATCCAGGCATGTGCAAATGGTGATA
GGTAAATCGAAAACCACGTTGTCGGTCTGGTACAGCATCGTTTCCAGATACTTGTTCGTGGTGTGCGGGCTGGATACTTTAATGGTGCGGATGAATTTTG
TCAACTGCTTCACCAAGTTCATTATCTCCTTGCCGCACTTGAAGGCGATGCGCACACCCTTCGCCATCAGCTTGAACTCGCCGTACAAACCGAACGTAGC
AAGGGAGAGTGCCGATTGTGCAATTACGGATACCTTGGACACGATTTCATGCACGCAGTCGTCGTTTTGCCGTATGCATTCCAAACCGCATCTTACCGGG
TACGCCAGCGGACATTCAGCCCAGCAAGCGTCATGGTGGCTATCAAACTCGAGCGGGCAGGTTTGTGCAATATGAGTCTCTCGGTAGCACGCTGTGTCAG
AGCCACCTCCAGTGCAGGACCCACCCAATTGGTAAACGCTGACTCAATCGTAGAGATGGTTGCTACACTCGTGGAGCCGGAGGCCATCGCGGTGTCTGAT
TCTTCGTCGTCGGCACTGTCTAGATCCCCCTCGTCGTCGTCTTTTAGTAGTTCATTGTCACCACGGTCGCCGCCCAAAGACCTGTTGTCGTCACTGTCGG
AAGCGCCGTCGTGGCTCGGAGTCGCAGTCAAAGAGCCGGTAGTAGTAGGTGTGAAACTTGCAGCATCCACGAAGGTGTATGTCTGCGCAGTAGAAGTCGC
GATGCCCGCACTCAGCAGTGCAACGACTTGGATCAGCTTGAGCATCTTGATCGATGCCATTTTTTTCACGAGCACAGCCCGTAGCGATTTCTGCGCGAGT
GCAAATGGTAACGTGTCTGTAAAATGAAAAATAACGTACGGTGTGCATACCAAAGGCTATCCTAGACGTCCGTCTTGGTCACAAAAGTTTGCTGCTGCGA
GCCATTTGTTCGTAAGACGACGCAAGCTACCGTCTAGCAAAGCTGCTAGGAAAGACCGCGAAGGCGCAATGAGATTGTGGCCACCAGTCTGGTGAAATAC
CACGACTTCGATGTTATCATCGATTCCAGCGCAAAGCCTAACCTGCACTATAATTCCCTCAGAGCAGTTGCTGCAGGTAGGCGATCTTCGCTTGGTCATG
CGACTAGCATTCACTATAATAACACCCGAGTGGCAGTACTAGCAAATGATTAGAATGGTGGTTTGCAAAAGATAAATTGTGATGTATGCCGACGGCATTG
CAAAGCTCACAAGTTGCGATTACTTGCCGCCCGATTTTTTGTTGTTCGTTCTCAAACCACAAAAAAGAAGCGAACTTCAGGATTGGCGATGCAGATGGGC
TGTGAGAACGTAAGTATTAATAGTGCTCGCTGCAGTGCTCACAGTCTCCCACAAAATAGATTGCATTCGTCCCGTTCGTCTCAAGCAGAACTGGCAGTAT
GAAATGTAACTGCACGTCTAAATACTTGTCACTGCGCAATTCATTCACTACATCGTTTTGCCGTTTTCTAATCGCTACACGTCCGCGGGAAGTGATTAGA
AAATGATGATTACAGCTTCTGCTCGGAACCACCAACGTTGCCTACGCAAGTGAGACGCGGCTATGGAGCCCGTCTCATGCATTTCGTCGTGTCATTGCCA
ACGCCAGCGCCAGCGCAGCGATGGCGTTGCAAAGTAAGCCCGCAAGGGTGTGCAAGCAACATGAACGACGCGAACGACACCTCTACACAGTCATGTAATA
AGCTCAACCAGGGACTGGATGAAGGGTGTTGTATCCGAGTAGACAATCCTGGTGGAGCGCTAAGAGGTTTGTTTTGTAGTCCGCAGAGAAAGTATGACGA
CCACACGAGTGAAACAACTCCATGGAATGCAGTGCTTTCTGTTAATGAACTGGTGGCGCCAAAAAAGTCACAAAGAAATAATACCTAAGCGACTATAATA
AAACTAATGTGGCCAAATGCCACAAAAATAGATGACATACAGGTACCTTTGCGATGGCTAGCAAGCAATGTCATTTCTTGTTGATAACTTATTATATTAT
TTGGATCATAGTTTCATACTTCTACTGACTCACTACACTTAACAGAAATGAAGGTCATACTAACTCACATTGAGCATCGCATGGAGCTGCAGGTTCCCGC
CCTGGGTTGACCTCGGAACCCACAGCAATAACGAACCGCCCCCTGTTCCGGGAAGTCCTAGAAAGCCCGGACGCCACCGATCAAGATACAGTGTCTTGCC
TCCCAGAGCCGTCATGTTCGAGGTCCACGTCACAGTCTGACCCGCAGCGACTGCCACCTTGTCGAACTTGTTGCCACCCGACTTAATGTTCACAGTCACG
TCCTCCGTGTCAGTGCTCTGGAAGTTGATCGTGACAGTGCCGTCACCGATCTTGGTCCAATTTCCAGCACTGTTGTTGAAAGCAGTATCCACTGCCTTCA
AGCCCAAGGCTTCTTCAGCAGTCCCGTCATCAATATCGCCAATGAATTCGGTGGGGCCACAAATGGTCTGGAAAAACTCGGAAAGCACACCGCCAATGTT
TTTCCTCTCCCAAACAGCGTAAAACGTTGCAACCTTGTCAGCGATTTTGTACATGTACTCCCCAGCCGTCAGAAGCGTGCCGTTGTTGCTCGTTCCAGAA
CTGATCAAGTCGTCCATAATACCCCCAATGCCCTTGCGCAGTGTATCTCGGGTCTTGTAAGCTGTAGCCTCGTCCGATTCTGCAATCAACTCTTCCATGC
AGTTGTTGGTCATGGTAGGATTTCGTACAGCGCGAGGTTTGACTGGCTTATCGCGACGCGGATATCGTCCTCGGAAATCGCTGGGTTCTGCCGGCGCATT
TCAGCCACAGTCATCCACGTGCGGTCCAGCAACCGCTTCATGTCGTATCCACATGTCGAGTTGGATTTCAGTGCGGTCTCCAAAGAAGTAATGTCCGATT
CGTTTAATGAAGAAATTGAAGCACCCAGCGTGATGTTCTTCATGAAGCCCGTGAATGCACTCCAACTGGAAACAATGACGGCGCCATTGGCGATGATTTC
CTTCAAAGCGAGCTCGGCTGTGTTGAGAATTCTGTCACAGTCTTGATCTGCTCATCCACTTTGATGCCTAAACAGGCAGCGATAGTCACTGGGACGTCAA
AGACCACATTGTCGGTCTGGTACAACATTGTCAGCAGTTGGTCTTTGGTGGTTTGAGGGTTAGATACCTTGACAGTGCGGACGTACTTGGAAATCGACTT
GACCATCCCCATCATCTCTTTGCCACACTTGAATGCAATTTGGATACCCTTTGCCATTACCTTGAACTCGCCATATACGCCGTACGTAGCGACAGATAGA
GCTGCCTGGGCTACGGCCGACACCTTGCTCACGACTTCGAGCGCGCAGTCGTCATTCTGCCGGATGCATTCGAGACCGCACTCAACAGGGTAGGTAAAAG
GACACTGGGCCCAGCAAGTTCCAAGCTTTCCGTCGAAACCGATCGGACATGTCTTCGCAATGTGGCCTCTCGATAACACGCCGTGTCAGCTGCGGTGCCG
AGAGCTGATCCTATCCAGTTTTTGTACGTGGAATCGATCGTACTGGTGGCGTTGAGACCGTTGCCAATGGTGAATCCTGCGTTCGCCGAAGACGACGTCC
CAGACCCGGTTGTCGCCACAGAACCATCCACTGCTAGTGCGGAGTCGCTTTCATCGTCACTGTCGGAAGAGCTGCCATCGTGGTGTATGTCGTCCTCACT
GTCTACGGACTCGTCGTCGCTGTCCTCGTCGCCCGTTGACCGGAAGGTGACGGTTGCGGTAGTATTTACTGTGTAGTTGGCGGCGGTCACCGTTGCAGCT
GGGACGGATGCTGCGCTTGCGTTGAATGTGAATGATTGAGCTGAAACATTAAAAATTGCCACGAAGACGAGGACAAGCACCACGAATAACTTTGCCATAA
GTCTCGCAAGGCGCGCAAAATTAAGAATGGCGTTCGACCGCCTAAACTCGAGCGTATCTGTATTACGTTCTTTTATCGTGCTGGCATGCGGTGACCGTCT
CAACACTTGTAGATTCGCGACCGTCGTGAGCCGCGCGACGCCCGGACATTATTAATCCAACCTTCAGACTTGTATCGAATCTAGTATTCCGGCGCAACGA
CGAATCTTGTAGGAAAAACGAGGACAACAGATCACCACGGGCAATCGACGGGCGCTCTTCCAGTCGTTGGCGGCCTCTGGTAGAAATCATTGGCATTGGC
TAACACATTCGGAGTACATTTCATGGCCAGCTGGTTGACACAAGTGGCACAAAATTGGAGCGAAGAGTGAGAGGGTCCGCCTTCGTGATTCAGTTGGCTG
AGGCGAATGCTTTCTTAGAATCAATCGACGGGACCAGAACCTCCACGTGGGGCTACCAAAAGGATTGGCAGGCCATAAATGGGCTCGCATATTGAAGGCC
AAGCGATTTGCATTGACCCCAAAGATTCGGGTCGAAGTGCCAAACTGTCCGTGTCGATCACGTCAATACATGAAGCAGGAGCGAGACGCTTTCGCTTGTG
TGAGTGAACTTTACTACTCGTGCTGCGGCCCAAAATGTGCAGCCTTCACCAGGCGCTGTGGGACACTCGTTTACGATCGAGGCCCCGTTGAAGCACTGCA
GTACACGTGCATGTGCTGCTGCAACCTCTCGCGTGCCTGGCTGAGGCGGGTGATAGCCGCGAGAGTCTCGCCGAGACCGTCTCAAACTCGTCAATCGTTC
GTACAATCGACCGCCAAACTCGAATCTACTCAGATACGCATTATCAGTTTAACAGCGCTAATACCTGAACTGCTGGCAGCACGGCAAGTTCTGGACCGCC
GACTTGTCTCCCTAAACAGCATGAGGTGATCCCGTTGGCATGGTCCCGTTGCCTCTCTACGGTACAGTACAGCCACCAATATCCCGCCCGATCTGACGCA
AGGGACACGACACCGCTGCAGTCCAGCTACAGGGTAACAACTCCCATCCGGGCCTTCCCTCCACGATTGTGGTTGCCCAAACAATTTATCGTAGTCGGAT
TGCGAGGGAAATCACCCAAACATTTGCTTGGACGCGGCAGCTTTTCTCCTCAGCGTTTGCAAAAAATCCCGACGCGACTGCGCATCGCTGTAGTGCCTAG
ACACTCCTTCGTCGTGGTGACCTCCACCTTCAACACTGTTTTTTGCCTGATGCACTCCATCTTCCATTGCTCTAATTTCGCCGCCTTTATCGTCAAACTC
GCCTGACTGTTCATACGAAAGCGCATCCATTTCGTGGGCGAGTAGAAATTCACGGATCTTGTCGATCTGTCCTCGCTCCGGAGCAAAGTTTGAGATCTCC
ACTTGGCCCGAAAGGTTGGCGATATCAAAAGCACGCTGAAACTTTGTTGACGAGAAAGGTAATGGTAGTGGCGACTCCACACCAGCACTACATCCACCGG
CAGCAGCAACCGGATCTACTACCGTGATCACTGGCACCAGAGCGGTTTTGTGCGGGAAGTAGTTGCAATTTTCCGGGATGTCAACCTGCACCCGTATAAC
TGCAGCTTGGCACCCAGGGCGGTGCAAATCCAACTCCCGCGCCAGATACCCAGAGATTCGCGCTCCTACCGCACAGTGTTTCAACGCGACATCCAAAAAT
TTGTGCCACCGTGAGCTACGAACAGCAAATTAGCAATCGTTAGCGCTCAACTTTCCAAAGTTATCTAGACCTTTAGTTGATACAGCAACTCACCGCTGTC
GACTGCTTCCCCCACCATTTCCATGCAGATCTCCAGATTCCAGTTCGGGCAGTGGGTAGTCGTCGAAAAAGACACAGTCAAATTGGTCCAGCGTTGGTAA
CTGCTGCTGCCACGTACCCGCGACTATTTCCACTCCATTGCGACTAAATGCAAACTGCTGAGCGCGGTGTAGTGTCTCCCGGTCGCATTCGATGATCGTG
TGGCTTTTGGGTCGGAATGTCTGGATGCGAGAGGCCGAATATGCCAAGCCGAAGCCGATTTCCAGCACACGATCCGTTGGCTGGATGACGAGCGCGTCCA
CGCACAGTTCCATGTACTGCATCTCCCACCGCATCATGACCTGCTGCCCCGAGAGCTCCAGAGGATCTCCTGCCCGAGCTCATCGAGCCCCTTGACGTTG
CCTTGCGTTGTCATTGAATCTGCTAAATATTTGTGATTTATATCGACCAAAAAATAGTCACCTATATTTATTAGCCACATTACTTTTATTGACAGACATT
ATTACAATCCTAAAACTTCCTCTCAGCTAACATTAAGCATCACGTTGAGCTGCAACATGCCGCCTTGGGTAGACCGAGGGACCCAGAGCAATAACGAGCC
GCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCGCAGTCACGTTCGACGTCCACGTCACGGTC
TCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGTATCGACGCTCTTGAACGTGATGGTTACAG
TGCCGTCTCCAACCCTCGTCCACATGCCATCACTGTTGTTGAAGGCATCTTGAACGATCGACATCCCCAATGCTTTTTTTGCGGTACCGTCGTCAATTTC
ACCGATGAGCTTCGTGGGGCCACAGATGGGCTGAAAGTACTCTGAAATCGTGCTAGCAACGCCCCACAAATCCCAAATAGCGTAAAATGACGCTGCCTTG
TCCGCAACCTTGAAAGCATAATCCTCGGCCTTCATAAATGTGCCATTGTTGCTCGTTCCGGAACTGATGAGATCGTCCACGATGCCTCCAAATGTCTTGC
GTAGCGTGTCACGCGTGGCGTAGGCCGCAGCTTCATCCGATTCGGCAAGCAGCTCGTTCATGCAGTTATTTGTCACGACGGGGATATCATTGAGCATTAG
GTTCGATTGACTCATGGCCACACGAATATCGTCTTCAGAGATGAACGGGTCTTGCCTGCGTAGATCTGCCACGGTCATCCACGTGCGGTCTAGCAGTCGC
TTCATGTCGTATCCGCACGTAGAATTCGATCCCATTGCGGACTTCAGTGATGTAATCTCTGTCTCGTTCAACGAGCCGATCGATTCGCCGAGTGTGATAT
TCTTCATGAAAGCTGCGAACGCGTCCCAACTGGAAACGATGGCATCGTCATTAGCCAACACTTCTTTCAAGGTGTACTCTGCAGTGTGAGAACTCGGTCC
GCAAACTTGACGCTATCGTCGACCTTGATGTCGAGGCACGAGGCGATTGTCACTGGCAAGTCGATGATGATATTGTCTGACTGATACAGTACGGCGAGTA
GTTTGCCTTGTGAAGTCTGCGGGTCGGAAACCTTGGTCGAGCGGACGTACTTGGCCAACGATTTGATTAAGCCCAGCATATTCCTGGCGCACTTGACGGC
AACTTGAAGGCCCTTCGCCAGCAATTTGAAGTCCCCGTACAAGCCGAGTGTGGCAAAGGACAGTGCCGATTGCACCACTACCGATACCTTGGTCACGACT
GCGAGCGCACAGTCGTCGTTCTGCCGGATGCATTCAAGGCCGCACTCAAGGGGGTACGAGTACGGGCACTGAGCCCAACACGTTCCCAGCTTTCCGCCGA
AACCGAGCGGACAGGCTTTGGCGATATGGGCTTCGCGATAGCATGCCGTCGAAGACGAGGTGTCCAGCGCTGTACCAACCCAGTTCACATATGTAGACTC
GATCGTGCTTGTAGCATTGGCAGCACTACCAATAGTGAATGCCGCATATCCTGAAGATAGCGAGGAACTCATTTGCGACCGAGACGCACTCACTGCCTGA
GACGAGCTGTCGTCGCTGTCTGAAAAATCACCGTCGGTGCTGTCGGAAGAATCGTC