Description :
From Genome Similarity Track
Location :
Scaffold_1016:2053- 4436
Sequence
2383 bases(100 bases per row)
TAATGTACTGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCTCCAACAAGTTGAATGCTGCCACTGTACCGTCTTAACACCTCATCCAAGGAAAATGTCATCACAGATGGTATGGCTACGAGTACCATGTTT
TCATCCATGGATCTAATGGATGAATTCCATCAGATCCTTATGCGCGAAAGGGACATTCCCTATACTGCAGCGAGCACCCCAAGCGGCATGTTTTGGGAGT
GGTTAGAAATGCCACAAGGCTAAGTAATGCCCCTGCCACATTCAACAGATTTGTAACAAATCTATTAAGATCCGTAAGAGCGATTGCGCCCAGTAACTTC
GATGATGTGTTCGTCCATAGCCGGTCTATGGATGGACGGACGGATGTGGAAGTGCACCGACTCCACGTCCGAAAAGTTCTTACACTAATGCGCGAGCATA
AGTTGTACGCCAACCGCAAGAAGTGTATATTTGCTGCTAGCGAAATACCACTTCTTGGCTGCATCGTGGGCAAGAATGGCGTCCGGCCCGATCCAGAAAA
GATCAAGGCGACCACCGACTGGCCGGTACCTACAGAAGCCAAGGGACTTCGAATTTCCTTGGCATAGCGGCGTATTTGCATAAATATTCACGCAATTACG
CCGAGATGACTGTTCATCTCTACCGTTTATTGAAAAAGAACGAGAAGTGGGAATGGAGTGCCGACTTCCAGCGCTATTGTGAAGGTATCAAGCAAAGCTT
GATACGATCACCAGTTTTGGTAATAGCAGACCAATACAGGCCATTCCACGTGGTCTGTGATACCAGCGACTTTGCAATCGACTGGGCATTAATGTAGTAG
GATGCAGACGATGCGGAGTGTGTCGTCTGTTACCTATTTCGCCAGCTGCAACCAGCTGAACGCAACTACCACGTCCATGACAA