Description :
From Genome Similarity Track
Location :
Scaffold_867:2053- 3340
Transcript NameFunction/comments
Phypl_g11360hypothetical protein PHYSODRAFT_549244

Sequence
1287 bases(100 bases per row)
cgccgcgctcgagacTCGCGCTGGCGGAAGTTCATGGTAGCCGTCATGTTCCTGAGCCAAgtgctcgtggagctgggccGGCGCGGCCTGCAGTGTGTGC
AGCGCAACGTGCCGCGCTACATCGCGTTCATGGACCGCTGGCTAGTGCAGTCTATCCGCATGTCGGTGTACCCCAGGAAGAAGGTGAGcacgctgcggct
gctgctggcgctggggctGGCGGTCGCGCTGCCGTACATCGTCCTGACTATTGGGCGCATGCGTTTCCCGGCGGGACGAGGGACCAAAGTGAGGTGAGAA
GACGGCAGGCTTGTCTGGCCGTGTGTGTGAGAGCAGAGGGGGTTGACGAGTTTCTTGCGGCGGCTTGCGCAgcgcggacgagctggacgaagagaaAATC
CGCTCGCACATCATTGTGGACCGGGTGGACACGCCGGTGCCGGGGCAGCGGCAAATGTTCCTTCGCGAAGGGGGCGACAGACTCAAGCTCGATGAAACCG
AGTTGAGATGCGAGAATACCGTTCAGGGCGTGAGGCTGCTCACCGACTCGATGGGTGAGCGACGGAGGTTTTTGCATTTGCTGGGACGAATTCCAGTGTT
GTTGATTCGAGCTGATGACTGGTGTCCGTGCTAATGGGTTTCTATTGCTACTAGGCTATGTGTGCACTCGGTCTCAGCTGGACAAGGTGAAGCCGGGCTG
CTGCAACGAGTCCGACGCCAGCCCCCCGCGGATAAAGCACTACACGTGCGACCGATGCGATACCAACCCACCACACTGCTGCGATGTGTTTGAGCACTGC
GTGTCCTGCTGCATGCACCCGCTCAATGTACGTTCTAGTGGCTGCAAGCGCAGTTGCGGGTGCCACctgcgctgccgctcgcCAAATTGGCGGTCGAGTC
ACCGCCTCAAGACCTGACTTGCTGACCTATGTTGAACTGTTTTTTGTCTTTTGCTATCAGTCCGGTATTCGCCGGGACTTCTTGACGCACGCTGACCCGA
ACCACCCGGTCTACAGCGACCCGGCCGAGATCACGGTGTTCCAGTACTGCCAGTACCGCTGCCGCACCTCATCCGCGAGCGTGCAGCACCAAAACTCGTA
TCGAAGGTGAGCTTCAGCGGCATGCGTTGTGGTCAGCTGGGCAGCATGACGTGTTGGTCAGCTAGATCTAACCAGAGTATGGGATCattgcttgcttgct
gccgTATGGGGCTGTGCCAGTCACCGCTCGTTCTGCTACGGCATCCACCGGCcgctgaaggtgctgccgACCGTCAACAGCGACGGC