Description :
From Genome Similarity Track
Location :
Scaffold_71:205297- 207834
Sequence
2537 bases(100 bases per row)
CTCTCCTTCTACTCAACTTTGGTAAAACACTACGACAACGCAGCTCTGGTCAAGCTGATTGAGCAGGCGAAGCTGGCTCCAAGCACACAGGCGATCGGCA
AGCGATTGCAAGCTGAGCAGCTCCGAGTTTGGCTGCGAAAAAGGACGCTCACCCGATGACATTTTCGATATTCTACTCAAGACAAAGATGCACGACGATC
TTTTTGACAACGCCAACTGGGTCCCTTGGGTCACGTATGTGGATGATTTCAACAAATTTACCCTGACAAGAAGATGACGACTTACTCGGTGTTGGAGGCA
CGATACAGCAAGCTTACTCTGTTCGATATGATCGAAGCTGCCAAAATTTCCCCCAAGACCAAGGAGATCGCGGCAAAACTGAATACCAGACTTGGCTGGA
CACCCGTGTATCAGCTGAAGACGCCTTTCAAATACTCCAACTTAGTAAGGCAAAGTCCAGACTTTTCGCGAGTCCGTACTTGGGTACTTGGGTCAACTAT
GTGGATGATCTGGACAAGCGCTATCATCAGAAGAAGTTGACGGTTCCACTACTCAAGAAATACTACAGCGATAAAGCACTGGCCAAGCTTATTGAAGACG
CGGCGAAGGTCCCGACCACGGAAAATATTGCTTACAAGTTGCAGAAGCAGCAGTTTGAAACGTGGTTCAAAAGCGGGAAATCTCCAGCTGAGGTCTTTCA
CCTGGTGCTCGAAATTCGCAGCTTGAAGAATCTATTGGAGAACCACTGTTCAACTCGTGGCACGCGTACATGCAGTACTACAACCTCATGAAGCCTGCAG
AGCGAACGACGGTGATCGAAATCTTAACGCCCCACTTTCGTAATGAGGCAGTGTGGAGAATGATTCAAGATGCGAAAGAAGTCTCGAGCACGAAGAATCT
CGCCTCGTACTTGGAGAAATCGTTGGGCAAGATGCTGCTGGAAGAAGATTGGAGCCCCAAGAGTGTCTCGAAGCTTCTGAATCTGCAAGCAACCGACAGC
GACTTTTTGAAAAGTTACACTGCGACTTTCAAAAAGCGAAATGATTAATACCATCAAGGACTCGCTTTAGCAAGGTGTTCTCACTTAGTGTAGATGCAGT
ATTCCTTGAGAAAACTGCATCCCAGGAAGCATAATTGAGTCGTTATTCGGATGGAAAGATGCACGACTTATTTTTTTCTACAGTTTTCAAACGAATTGGA
TCGAGAACGGCTGGGTGAATAAGGCAGATAACGCGCTGTTGGATCCGAAGACGAAGCGTCTTGTCTCCAACATGCCAACGGAAATGCCCATGAAATTCAT
CTTTGTGCCGAAAAGCAGGCGATTGCAGTCGCTGAGCGGGAAGGAGAAGACGTGCTGGCATTCATCGATGGATCCTAATAAGTCAAGAGTCCTTGGAGAT
TGTCGGGTTGGCAAACAACTTTTCTCCGGTCTTTTGAAGCTGTAAACACACGAGCACGTTATTGAGGGTCTTCCTGTTGTTAGGCCACTGCTTGAATTTT
TCCTTGAAAACGTTCGAGGAGGTGAAGACACTCTTGGTTTTCTCGATGGCGTAGGCATCGAACCCCCTTTCTACGTCGTCTTCACCTTCGTCGGCACTAT
ATTCCCTTGGGAACTCGTAGATGTTATGCTCGGTAGCGAGAGAGCGATCCGTCGTTGGCTTGAGCTCGTTCGTTGCTTGGTTAGCATCGACACAAGCAAT
GACGGCGATTTCCAGTAGCAGGACGTAGTGCGAATTGCGTCGTCTTAGAGCTGAGTGATGCAGAATACGGACTCCGAATCACGGGTTCGAACGAGGGTCC
AGTTTGTATGATTCAAGTGATAACTGACACGTGATGAATCATTGGATGGGATCACACCCCCCTGTTGCCAAGTTGTGAGTAGGCCCCTCGAACGGGATCC
GCTAAGGAGGGCCCTCATCGGGAGGGCCCTCGTAATAGAGTCGACATTTGGGAAACAGCCGATTGTGACAAACGCACATTTGGGTCATTCGTAATAGGTA
CATGTACCAAAACGAGAGCTCGGTTCATAAAGCACTCTCCCACCTCTCATGCGTGTCCACCGCGCCTTCTTCGCCTGGGCACCCCAGCTACAGCAAGGGC
AGGGAGTGTCTGCCCAGGCGAAGGTTTTCGCTCAAGAAGAGCTCGACGGCGCGCATGAGGCTGCAGTCACCAAGGCATGGCTCAGCAATCGCGCCGGCAA
GGGCCTGCGCGCGAAGTGGAAAGCGCTAACGCCAGAAGAGAGAGAGAGCTTCTTGCAGAGCACTGCTGACGACACGTTCACTCTGGAAGAAGCGCCCAAC
GGGGTGCTAGACGAGCGCCAAGATGGCGCTCGTTACCCACATCGAGCCCGCGCTGCTATCACTTCGACTGACTCGCGCGTTGGTAGAACCTGCGACGCCC
CAGTTCAAGCGCCCGAGTCGGCGGCCGACCAGGCTCTGGCCAAGCTTCTACGACAGCGCAACCAGCTCTGTGGCTCTGTGGCGCGAGCCGCGATGTCGGC
ACAGCTGGCTGCTATGGCGATGGCTGTTCGGAAGCGT