Description :
From Genome Similarity Track
Location :
Scaffold_296:20528- 32674
Transcript NameFunction/comments
Phyke_g7969hypothetical protein PHYSODRAFT_334994
Phyke_g7970hypothetical protein PHYSODRAFT_334993
Phyke_g7971hypothetical protein PHYSODRAFT_512543
Phyke_g7972hypothetical protein PHYSODRAFT_334991
Phyke_g7973conserved hypothetical protein
Phyke_g7974conserved hypothetical protein
Phyke_g7975hypothetical protein PHYSODRAFT_346958
Phyke_g7976hypothetical protein PHYSODRAFT_346958
Phyke_g7977hypothetical protein PHYSODRAFT_354955

Sequence
12146 bases(100 bases per row)
AGAACTCAAGCAGCGAGCAGTTGAGGCACTCACAATGGTAGGATACGCACAGCGAGCCGTGTCATGCAGCCGTCGCGCCATCGCCACAGACCGCATGCTT
GTCAGAGCGGAAAATGCAACAATTGTTAAGTTCGTATTTTGTCCAAAATAAATAGTTGCTTCTTTCAAAACGAATAATACCAACCTAATCAATTTGGACC
AGAGGAAGTGTTATGTACGTTTTCAATTGTggccgacgacgatgaaggtgCCCAAGATGCTGATCGACTACACGGTGCGCTTCGGCGTCCCCATCGGCCT
GGCTTACTACTACTGGAACCCTCGATCTGACGAGGAGATCCGTCAGGACCTGGTGCGTATTGTCTCAGTCCAAAGAAAAAAGCTCCATTTGTTCACTGAC
ACAATCGTCTGCGCAGGAAAAACAAATCAAACCTGACCCAGAGATGCGAAGAAAACGCCAAGCTAAATtcgcagagctgctgctgcaggggGATGGTCTC
TCTGACGAAtcgaagaagcagctggaccAGGCCACATCGTTCACCAAGACAAAGAAGGAGTATCTTGCTGACCAAAAGAAAAAATGAAGCGGTCGCTTCC
AACATAGAACTATTTTGTTGGCTCCTGTTGGGATCAGTGCATATATCGTTGGATACGACTGCAGTGTACGGATTCCACCTCTTTCAGAGCGGTCTCGAGC
TGACGCTGCATCAGTCGAAGACTGTCGTAGTCCACACGGAGGCATGTAGATTGGACTTGGGGGACGCTAGAGCTGCTGGGCCGTGTGGAAGTATCAAGCC
GAAGCGTCACAATTGGTTTCGGTTTGTTGCGAAGGAAGCGCGTACCAAGCTGTCGCCATGAACAGACAGAGAAAATTAGCTCATTGTAGTCACCACTGTG
TTCAATTCAAACACCGCACCTCCAGGTCGATTCGCCACTCTAGGTTGCGATAATGCGGGATACTCGTGCCTGTTTCCTTTGTGACGCACGCTCGGATATC
CTCTGCATGTGCTGCATACAACTGGTATTAATACGCTCTCGAGTCAGTAAAACTGTGTGAAACTCCACTGCAATTGACCGAGGTTGTTTTGTACCTGTGT
GAGTACTTCAACATGGTCTTCCAACATCTCCATGCCCTTCAACGCCAATCTAAACGCTTGCTCTGGTAGCTCAGTCTGCAATCAAAGATAAAAAATACTC
TGTCTTAGTATTTCCACCTCCCTAGGTACTTCAATTACGAGACAGCCGAATACCTTGGCGGCGTCCATGAGGATCTTTGCAATGGCTAGAACTGcctgct
ccatctgctggGTCTCCCATCCAGAAGACGCTGATTATTGCATCAAAGCAGTCGGAAACACAATATTTAGCATTTTAATACATGTGTTTAAATACTATAA
TCACGCGATTGATTTGATCTTGAACGCACATGCTGTCCGTGTCAACCGGCGCTTGCTTTGCTTCTCAGACCCAAAAACTCGCACCGCCAGCTTACAAGCC
GCCCCAAagtctgcagcaaacacGTTTAGATTTGTGTGGATAGTATGTCATTGCGTTGATACGTTGGCGTACTCTCAGCTGACAGCGCGGTGGTCTGCGC
TACGACCTCTAGCACACGCTCATCCGCCGCGAAGCTCCTGCTCATGTCGTCGACTTTGAAATGGATCGGCTCTGATACAGGATTAATTTTGGCCAATCCA
ATAATGTTTTCTATTTTCAACGAATGAAAAGACACCTTGTGACGGctgttttgaccaatgaatATTCGGAAGGAGTGGCGCTAAAGCTTTGCATCACACA
CACCGAGATCGAGCGACCGaagacgatggcgacgaacGGGGCAGCTGGCGGCAGTCGCAGGGACCCGATCCTAGACCTGGCCAAGTACATCGATCAGGAA
GTGCGCGTCAAATTCCACGGCGGACGCGAAGTCACGGGCACGCTCAAAGGCTACGACCAACTGGTGAACCTAGTGCTGGACGACTGCATTGAGTTCCTGC
GCGACCCGAACGACGAGTGCCGGATCACAGACGACACGCGCAAAGTGGGGCTTGTGGTGTGCAGAGGGACGTCTGTCATGATCGTGTCTCCTGTGAACGG
CACTACGGAAATCCCCAACCCgttcctgcagcaggaagGCTAGACAAATGAGCAAGGGAGACGCTAAACAGGGGAACGAGTAGGGCCTGGGCATCAGACT
TTGACGCGAGTCTTACGATGATGGAACGATGTAAACGACGCATGACTCATGGTTCTATGTGGTGCTAGGTTATGACAGAGGCTATTCTAGATAAAAGTAT
CAAGATCCATGTTCGTGTTTCCTCTCCTATAACGGTAGCTGCGTCGAGGTTGCAACATTTTACACGCTGGCGTCGATCAAGCGGATCTTGTAGACAGCTC
CCCATTGTTTGCCCGTGACGTAGAAAGCGTCCTCCTGTTCATCGTAGGCGATGCCATTAAGCACAGCACCAGACTTCACGTCAACGCCAGCATCCTTTAC
CAGTCTCGACAAATCAAACATCGAGACGACGGCACCATTCTTTGGGTCGATCTTCAACACGTAGGGCTGGTACCACACATTCGCGTAAATGAATCCGTTG
GCGGATTCCAGCTCGTTAATCTGAGAGATCTTCTGGTCTCCATTGTAGATCGAGACGTCAACGCGACGAACTTCTTTCATCGTGGACGGATCCCAGAACA
TAATGGTCGAAGAGCCATCCGACACTGCATAGTTCTCGCCGTCAAAGTCGATGCCCCAGCCTTCACCTGTGACCGTCTCGAACTCAAACTCACGCTTCAG
AGTAAATCCGGTCTCGGATGAAGAACTGTCATCCAGATTAAATACCAGACCGATGTCATTCTTCCACGTCAGCATCACGAACTCGCCGTTTGGTCCCACC
GTTACGCCCTCTCCGAAGAGCTCTTTGGGCAGATTGTACTGATCCAGCACTCTTCCGCTCGAGATCTCCACACGCCGCAGACTTGATTCTCCATGCAACC
CTGTAGACTCGATCAAAAACTTATCATTGCCTCTTGTGATCAGTGTCAAGCCTTGGGTGAACGCTGCACTGTCGTGTGGATACTTGGCCAGGAATTCGAC
AGTTGGTTGAGCTGCAGTGCGACGACGCACCTCCTCTGCAGGACTCAAATTGTGAGTGGGGAGCGTTTTTGGCGTCTTGAAGTACGACATTCCTGCAACC
AGAAACGCCACCAGCCCCAGCATGACTGCGATCACGGTAATACGCACCAGGACGCGGGACATCACACCCGTTGGAACTGCTTTCGGTGCTTTCGATGCTT
TCGCAGTCTCTTTTGCGTTTGATACTGcattctccttcttctcccgACGAGTGGGGCGTCTAGAAACCTGGTTACGAGCCATCGCGTCTATCAATCAGCA
GAGCTGCAGTACTGTAGAGCAGTGGTGCGATTCTGTCTGTGGCTCCCCATGATGGAGTGACAAGATGATGACGTACTGGGATAGGCATTCACTTCATTTT
TGTATCTGCTTACAAAAGTCAAGAGATAGTCCGATCCATAAGTTTTTGTTAGGCTTTATGTAAGGTTTCATTATCTCGCAAGGAGATTGGTTAAAATAGA
GTAGATTGTTTTGATTGGTAAAAAATCTGTTCAGCACCATTGGACATCCATGCATTTGACAAACGACACCTGCATTACCAAGCTTTGAAGTCGTGCCCCG
CTCTGTCTGTCTGTATCCACACCACCTCGTCCATTTCAATTGCAAGAAGAGATTCAGACGATTGCGATCCTTTTGCACTAAATTTCGACGTAATAACCTC
AAGAAATGGCTCCTACCAAGCGATTGAACCTCAGCAAGTCTCGCGACGACAACGAGAGCTCCTCAGCTTCGTCTACTGACGACGAACAGGAtcagacgca
gcagcagacaaaggagcaagagcaggaagaggatTCTAGCTCAGGAGAGGAGTCGGACGAGTACGTTTGCAgtcgaattgctgcagtttcgACAGACTCT
ATGTAGATTTAGATGTGTCATTCTTGTTGGTTGCCACAACTGACGTGTCATTGCTGATTGCAGAGAGTTCGAGATCCCGCCGGATTTTAAGAGCGTCAAG
GGAAGTGCAGCAGTAACACGCGAATCTGTGCTGTCCAGCGGCCAGGAATTGTGGTTCTTTAAGCTGCCTAAGAACGTAAGTTGTGACGAACGCGTTGACA
AATCCTTGCATCGGAAGTTGCCCTATACAAGTCGTTGCGTATCTGACGGTGTGTTTGATGTCTTTGTTGTGCAGTTGAATGCGTCAGCACTAGAAAACGT
GACGATCAAAATTGGTGAGGGTAAGAAGGTAACCCCCGGTGAACAGTTGGCCAGACTGACGGCTGGagaggacaagaagaagtacGTACTGCAAAGCGAG
GACGGTATGCTGACAGACCAGCTCGTGAACGCACTGCCGCTTGCCTCGAACCGTGCCCGTTTTGTTCTGGGCAAACCATTCTCGCGTTGCTTCTCGCTGG
TCGAGGACCACCAGGATGCTACAGTGGCGGCAGTGGCCAGTTCCAAGACTCAGGAAGTTGAGGCGTCACCCGTCGTtgaaaagcgcaagaagaaatccTC
GTCTGATAAGCAccacaagtcgaagaaggccaagcacAAGAAGTAGATTCCCTACGACGGAGAAAATAACTCAGCACTCGATAGACCACAGAACAGCCAT
GCAAGAAAAAATCATCACCTATTTGTCATTTTGTTCTTCTTTATCGGGGTCGTCACACAGCATGGCATAAGGCCTTAGCTTCAACTTCGCCGACAAATGT
TTGAAAACACAGAGGTGGTCGTCTAAAAAAGCAGAAGCGGCTCATCTGGCGGCGGGGCTTCACGGCGCTTCGAGCTCTTGTGCTCcttgtctttcttctt
cttcttgctcttctcaGCCTCCCCACCATTTTTACTTGAGCTTTTTTTCTTGTGGCTGCTCTTCTTTGTGGATGAGCTTTGGTGACGATGGTGGCTATCT
TTCACCGCAAccgcttcttccttgtcaCTAAAGCCGCCGATGAGCAAGTCGTCTTGTTTTTTTGACAACTTCTTGGATTTTGAGCTCTTTGATGActcct
tctttttcttcttgctgccatCCTCACCATGAGAAGACTTTTTGTGTTTCGagcttttcttcttcgacttctttTCACTCTCCGCTGGCTTAGCGGATAC
AGTCTGACGGTGAAACCAGTGCTCATCGGGGACCCTTTCGTTTTCACCGAGCGGGATACTTAAATCCACTGCGGACAAATCAGTCTCCTAGAATTTCACA
AAATTGCACGTGTACGAGAGCGAGTGAGACAAACCGTACAAAAGAAATCAAGGAATGTCGTTCATGTCGACGAACCTCCTCATCAATTGAATTCCGTTTT
TTTCGGGAGCGTCGACGATCTTCATCACTTGAACGCGCACCTTCAGGCATCATCTCATCTTCCAAAATGTCCCGGGACTTTGATTTCTGCTAGTCACAAG
TACACCGCACGTTATCAGCATTCGTCCTATAATCCATGACAGAGCTACAAACCCTACCTttgacgccttcttcttcctgccgTTTATGCTAGAGCCCAGA
GCGCCCATTATGTCAGCAAAGCCCTACAAACAGCccaacacacacaacatTAGCACCGGCTCACGAATAGTTATCGCTCAATAGGCTACTTCGTACCGTA
TTGGCAGCATCAGTTGACACTTGTGCTCCAGCAGATAAATAGAAGGGATCCTTGCGTAGCCGTTCTTGTTCCTGCACGTATTCACGCTGccgcttctcct
tctcatctGCCGAGTCTTCGGATTCCGATTGCGAGTCTGACTCCGACGAGGAGCCGTCTTGGCGACGCTGATGATTGTGTTTGTGTCCAGGCTTGCGTTC
GGGTGATTCGCCCCCAATGCCACTatagccaccaccaacgccagcatGACCCTGGCTCACAAAGGAAACCTCCAGATCATCCTCACTCGAAAAAGCTGAC
ACGTCACCGCCTGACTCAAGGAATTTGGCCTCTGAGTTACTCAACGGATCGTCAAGATCCAAATCACCAGGTAATGGAACCTTGCGTTGTGCCTTGACAC
CTACTGGTGCTAACCGTTCTGCGAAGTACGAGTTCAGCACATCCAAGCGCTTTGCGGGGTCTAAAGAGGCACTGCCGTCGAACGCGCGCTCGGTACGCTC
ATGTGCAGAAAGAGCACCCAGACCCATGCCCAGTgccagcagaagctgctgtagaCACACAGCACGTTCCTGAACCTCAATATGCTCACTTTGAACAAAC
GCGGGTAACCTTTCCATGATAACCGTAGCAATACGCTCCACTGTGGCATCATCAGCTCGTTCTGCCATAGCTGTGAGGATTTTCAAAAGCGCTTGAATAA
AGACAGTTTGGACGTGGCCTGGCAGCGTCGTCGTGCGGGGCTGCAGCATCTCATCTGCGAGATCCTCTAGTCTCTGGAgcttttcttcctccgtGTCCCg
atcttcgtcctcttcatcctcgtcgtcttcgtccacatcgtCTAGGTACTCCATGACGTACTCGCCCGTGATCCAGGCTGCCGCATAGAACACCTCTTGT
AGGGTTCCAGAACCTGGACCACTCAAAGCCTCCTTTTCGATCAACAGATCAATCATATTCTCCACCATCACACTACGCACACTCTTCACACGAACTGCAA
TATCTACAAGTTGACGCGCCACCTCCACACCATGAGAGCGCTTCGGGGGCTCTTCATccgccaccttcatcttgcggttgctgctactgctggagcCAAG
CATACTTCCTGAAGACGGGGCTAATGAGGACAATGACGCGTCGACCGTAGCCGCAGTGTTGCCCGGTACACGAGCAAGCTGGACCAAGACGTGAATGTAC
CAGTCAAAGTCGTGGATGTTCGCATACTTATTGACGGAACAAACGTGTAAGATATGCGTGATGAGTTCATGACGGTAGGCTCCGTCGGCACTCAGGGTCT
GGCGCATCAGCTCACGGATAATAGGAGCCGCGTTGTCCGGGTTGACCATGCCggacagcagctcgagcgATCTCATCCGGATGGTAATATCGTCAACGGC
TAAGCACTCAACGATCAGTTCCTGGTGCTCTGTAACAACATACGGATGCGACCTCATCAGGTTACCCAGCCCGACGAGCCCCAAGTAACGAAGATTCTGA
TCCGGGTCTTCAATATAACGGCGGAGGTGGTCATTACATAGCCTGACAACCGCCGCCACGTTACGCGGCTGTGAGCCATCACCCTTCTTGGTGTACAACA
GTGCCGTTGTGACCGTGTTAATGCATTCGTAAAGTAGCGACTTGGCAGGCGTGTTCTGGATGACAGTCGCAAGTGGGTCCAGCAACTTTCGGGCAAGACG
AGGCTCTTCAGGCACCAAACTGGCCAACAACTTGACCACTTTAATGAGCATCCAGTTGTTGGACGATGTGGTAAGCAGTCGGAAGAATTGCGGCGCCAGT
CCCAAATAGTTTTTAGGCTTTTTGTTCGCCAGTTCGCAGATCACGTTCACTGCACACGACACCACCGTCACATCAGGCTCCTCCATGCGCTCTTTCAGGC
GGTCAAACGATACTCGCAGTCCTTGTGGGTACCGTAGGAACATCTTGAAGAGCACCAGAGTAGCTTTCTTGCGTACATAAGGCTTGGGCGACCCCATCAT
AGCCAGCACATCACCCAGCAAGTCTCTAGCCAAGTCCGTCGTGACGATATTGGCCAGTACATTGATAGCCAGCCCCACTTCGTGCTCGTTCGTACTGCCG
AATTCCTTCTTGAGTAGATTTGTACATAGCAGCACCACATCTGTAGACTGAGTGAAGCTCTGACAGGCGGCATTGTAGCCAATCCGCTTGTGCGCAAAGC
GCTCGTAGCTCATGACCTCCACCACGTGGAAGGCAGCCCAGCACATATCGTAGCCAAGCATGTGTAGGTACGTGAGCTTGCGCACCGCTTGTGACTTGAT
GAACGGGTCGGTACTGCGCAGCTCCGTCTTGATTTCTTGCATCGCCTGGGAGATGTACACGCTCACATCGCCCTTGGTGGAGCGGATGCCCTTGACCAGG
TCCTGGAGGTTCTTCTCGAACATGATATCTTACTTCTTCGTCTGATTACGGACGTTCTAGAGTGGTGTTAGCCGATTGCAGCACAGCGATATAGAGTTAG
GACACGATGTTGTCGATGGAGACTGGATTTGTGGCGCACTCGGTCCCCCCGCCGGTGAACTGTGGACGCCAAGCGCGAGTGTCCCGCTGCGTAGCGCAAT
GCGAATCAAGAGGCCGAATGATCGCAAGGGGGgaagtaaaaaaaaagacgattttggccaatcaacATGGCGAGGATCTTTCCATACAATATTGCAGATT
ACAAGGCTGTGCACCCTGCAGATGGCTACATGGCTACAATGTGCCAGCGTGCCAGCGTGCCAGCGTGCCAGCGTGCAATGATGTCTGCCAGGATACTTAG
GAGGAAACAAACATGCACATGTCCTGGACGCTTCAAAGCATACACATAGATTTCCCACTTGACTTGAACGATGCATTTATTTTGTTGCAACTCTTGACTT
GTCATCAATCATTGAAACTTCACCCCATGACGAGCTCCAACAGAATCATCAAAGTGTTAATGACCATGAGCGGGACTGCACGCAACCAAATAAAAACAGC
ACAAATAGAATAGTGTTCGGAGAGGTGAGGACACAGATATTGGTAGGCAGGAGCTGTGCTCCACCACTTGCAACACAGTCAGGTAGCAGACAACATACAT
CGGAGGTACTGGACGGCAATGAGGAAGCCCACGATCTGGTTCTTGATCGTCATGCCTTGCGACGAGTCCACCTTATCCCAGCCATCTACACGGGAGCAAA
CACAGCAGAGAGTCAGTAATGCACTCACCAACTGTTCGACATTTACCCCGTGACAAGTATCTAACGAAGCAGGGTCGTGGGGAGAGTACGCACGTGAACG
CAGGAACCGCTTCTCGTGCAGAATGCACACGGCGTTCGTGAGCAGCAGGCTCGTGAGGAAGAAGTTCCACAGCACGCCCATGTCGCTCGCTCGCTTGCAA
CTGAGGACTTCGCAGTGACTTAGTCGAGATTTTTTATGTATATCTAACGGAGTAAGTGTAACCTTGttgaagaaattgaagcagACCAGGAAATAGCAGC
GGCtgaggtgctgaaggagtgAAGTGCTCATAGGCACGATACGCGGACGGGAGTATGTGCCTGATGTGTTTATTGGGAGGGCATGCAACTagttcttcca
gcagaaTAGGAACCTGAAACACGCAAGAGTAAAAGGAGCTACAGGCTGACAGGGCTAATGATttcttgaagaagtggcTCTTGGATGTGGTGCCACTACA
CGATTGACTACGTGATGATCACCTCCAGCTGCCACAAGCATTTGATACGCTGAGTAAAACCCATCTTCAGCCTTGGCGTCTCGAGCTTCAGTTTGTCCAT
GAGAAGTTGACACTTCTCTGCCACCGTCTCACTTCCACTTGGCATAAACACCCAGAACTTGTCCAGGATCTCGGTGTGCTGAAGGCGGTTTAGATATGCC
GCACGTGAAATACGAATCGCCTCAATTACACCAGCCAACTCCAAGCTTTGATGGTTACTTTGTGCTATACTAAGTTCCCCGCATTCCACAAAGCAGTTCA
CCCTTTATTCAAAACGTTTTGAAGGGGTTGAGCAGGTGAGTCCAATGACGGACGCAGGATGGGGCTTCATCGTGTTGTTCCCTCGCTATTATAGGAGGAT
TCAGCGCCTTGGTAAGCTACGATGAACGACTTTGTCCATTCACATTTTAAAGGCCGTCACACTGGGTTTATTCACGTTGGCCCTACCGCTTCATGTTATG
CGAGAAGAGCTTAAGGCAGTGCTGTCGTACCTGCTCGGTCGAGATGGAGCGGCAACTGAGTTGAAGGTGCAGACATCAATTTCTAGTCCAGGGGCATATG
CGTATTATCTGGGGGCAGTCGTTGGCAAATAACGTCTACTTGGACTTGTGATGGGTCCTTTGTCGCTTTTTTTCAACTCGGCAGAGACACTGAGAAGCAA
TCTGGCTGCTTGTTGCGTGGTCAAGAAACGCTATTGGGACACCTGAGttctggcagcagcacacgcagtTCGAATCCGCATTTGGCATTCGCTTCCACAG
CTCAGTCACAACACCGAATTAGGACCGAATGCCAtgctgcagttcctccagtCAATTGCGCAGCGTTTTGTTGTTTTACGCAAGAGCCAGAGCGACTTCA
GTGATCTCCAGCCCCGACAAACCGAAGTACGATATCTTAACGCAGGACAGGGTCTTGTTGCCAGTTTCCAGCACAATGAGgcagcgatgaagagctacGC
GCAGGAAATCAACCTTGCCCGCATTCGAAGCTTGAGTTCCGAAGATCGCCGAGCAATTGCCCATCGCCTGAGTACCAAGTCTAAGTACACTTTGCCGATC
CTCACGCCACGACAGCCTCGAATCGAACGCGCGATGTCCATGACGTAGCAACACCCTCCAGATTCAATTTTGCAATGGTAAACACCCTTGGGCTCGTTTG
AAAATCGCTCCATCGTACATTATTATATTTTTCTGGTGTGGGTATTGGTACACTCGTACTGCGTGCTTCACAGTAGCTGCTTTCACGGTCACGATACGCT
GGATGGGTTCTCTCGAATCGCTTCTGCGTACGGCGGCTTCCCTTCAATCGGTCGCTAGcttgcaaaagctgctcgCCCAGTCCCTCGTCGTGCCGCTCGC
TCGCTCATTGCTCATCTTCATGCcgttctctctctctctcttcctctcACTCTGCTGCAAACTCTTTCTGGGCTTTCCTATCTTACTATGCTACTTACTA
TTTATTTTTTTGACATTCCGTAGCACGAGTCccgctgctgttggtttTTGGTTGTCACCAGAGCTTGTGTCGAATTGCCAGTCTCCAAAAGACCGGCACT
CGACCACAAAGCTCTGTCTCAGgtctttttctctctctcttttgAGTCGAATGGAGCGCGATTTTCTTCATTTTTACTTGATCAGGCAGTGTCTTCAGTC
AGTCACCACCGTTGGTTGTCGCATTGCTCACTCACTCCGGTACGTGGAAGTTGCCGCCGCACGTCAAAAGGCTCGACGTGCAACGTTTACTTCACCGAGC
GGGGCTGGTGCAACGTCGAGCGCATGCTGCGCTTGGGgtagttgaagctgttcttcttctgcagatGAACCgtcttggagaagctcttggccttggcagc
cttggCCATCATGCTGTAGATCTCGGCGTCCACGTCTGAGCTGGAGCGCAGCTCGCGCGTCTTCTCACTGAGCTTGTGGTGCAATTCTTGGTGACTCTCC
atgatctccagctccgccagGACCTCGTTGACCTCGtccacctgctccagctccagcatctctgTGGCGGTCAGTGGGTAGAAGGCCGGgtcgaagagct
cttcgtcCGGGATTTCTTGCACAGGTTCGACGGGGTCAGCGATCACGAAGCCAGATTTGCCAGGGGAGTGGGGGCGCTCGAGATAATAGTCGTCAGTGAT
GGCTGGGTACCACGTCATGGAAGGGTAGAACGGCGGGGCCAGTGCGTCGAGAGTCGACGAAGGGAGCGGTGATGATACCATCGCTTAACTGTGGGGGTGG
ACTGTCTTGTGGCTTGGGAGGCAAATTGCGATATGGACCGGGAAGGGTCGCCAAAAAGCGCGTGCTTCAAAGAGACGATCCTACGAATTAGGAAAGGAAT
TAGGTAATTCAGAGTTAAAACAGCGTGTTTTACGGAGGGGGGAAGCTGAATAAGGCAATGAAGAAGGAATGACCTAACCGCTTGAAACTGACTTCAACAT
GCTTTAAATAGTGCGCCTAGAAGAGCAGGTTGCGTTGCGTTACCCTTTGCCCTTTGCCTCGGAGCTATAACTGGTTGCATCGCACTTCAATATGCATCTC
GTCAGTCGAGCGTCTCATTGTGCTTTCCGGTACATTGCAACGCGAGACAGAAACAGGGTGGATGGATGCATTCCAAGCAGCCATCGAGAGAACGCCTACT
CGCGCAGCAATGAACGAAATGCAACAAAGGTCTTTGAAACGCCATC