Description :
From Genome Similarity Track
Location :
Scaffold_84:2052- 6528
Transcript NameFunction/comments
Hyaar_Emoy2808596hypothetical protein

Sequence
4476 bases(100 bases per row)
TCCCCCCCTTGAACCAGAGTCACATTCTACTAGGGGTTAGGAGTAGATGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTTGTGAACGCATGCACGGA
GTTGTTGATGGCAAACTCAACCATCGGCAAAACTTTGCTCCAATATGTGAAAGATTGGACGTACCCGCGGAGAATTTCTTCGAGGACGCGGTTGAAGCGT
TCCATCTGACCATCAGTCTCTTGATGGTCGGAAGTAGACATAGTCAGACGTGTTCCGATCGCTCGGAACACGGATTGTCAAAACTTCGCCGTGAACCGTG
GAACTCTGTCAGAGACTAGTTCACAGGGTAGACCATGGAGTCGAAAGATAGTGTCAATAAAGACACGAGCACAACCCTGTGCTGTAATCGACACCTGAAA
TTCAGCAAGGTGTACCATCTTGCGAATCGATCAATGAACACAAGAATACCATCATTATTGTGTGGGTCTTCGGGGAATCCGAAGACAAAATCCATTGAAA
CGGACTGCCAGCACTCTACCAGGATTGGTAAAGGCTCTAGTGGCGCTTGGGATGAAGGACTAGGCTTTACCCGTTGACACACTTCGCAAACACGAACGTA
CTTGCGCACAAACTGATACTGGTGAGACCAATAAAAGTCGCGGCTTACCGTGAGATAAGTCTTCTCACGCCCACGATGTCCACTAGTTGGTGCATCGTGG
CACTCATACATGATGCGTGAGCGCAAATCATTATGAGTGGGAATGACGACACGAGGTGCGTCGCCGGCAACGGCTGTGTAATACAGAAACCCGTTGCGTG
TTGTGTATCGATTAGCGGATGATCGATACAAGGCCGATAAATCTCTGAAAGACTAAAGAGATGGATTCACCAGATGATCCATTAGTCGCAGAAAAGCCTT
TTCTTCTGCGTAGGCTTTCCTTATGTCGTCAGCCAGTGTTGACGAAGTAATACTAGCCACTAGTGTTGCAACAGTGGGATCAATCCCACTGTTGGATTGC
GCAGCCGACTCGAAATCGGGTCGGCGTGATAACGCATCAGCGACGACATTAAGTCGTCCTGGTTTATATTCCACAGAAAAGTTATACGCCGCGATGAAGG
ACAGCCACCTCTCCATTCTTTGGTAGAGGTGTGGACTGTTTACAGCCATGCGTAATGACGTACGGTCCGTATAGACTACGAACGGTCTATCTCCTAGGAG
ATAGATGCGAAACTTAGCCATTGCATACTTCATGGCAAGTAGTGCCTTGTCATGCACTGAGTAATTACGCTCAGCTGCTTGCATCTGGCGCGACTGATAA
CCGACGACGCGCTCCGCGCCGTCTACGTCATACTGCATTGGCGCGCAGCTGATCGCGAAAAACAAATCACTGGCATTACAGACCACATGGAATGGTCTGT
CCTGATTTGCAATCGCCAAGATAGGCGATTGCATCAAGCTTTGCTGATACCACAAAGGAAAGCTGACAATCAGCGTTCCATGACCATTTCTCGTTCCTTT
TCAAGAGACAAGGAAGATGAACGGTCATCTCGGCGTAGATGCGCGAGTACTTGGCCAAGTATGCCGCTAGTCCAAGGAACCTTCTGATTCCCTTAACATG
GACTGGCACAGGCCAGTCGGTGATCGCCTTAATCTTTTCCGGATCAGGGCGTACACCGTGTTTACCCACGATGCACCCAAGAAGTGGTGTTTCGCTCGCA
GCGAATATGCACTTCTTGAGGTTGGCGTACAGCTTATGCTTGCGCATAAGTGTAAGAATTTGAACAACGTGCGTTCTTTGAACTTCCACGTCTGTCTTTC
CGCCCATAGCACGGCTATGGACGAATACATCATCGAAGTAACGCGGTGCCAAATCTCGCACCGGTCTCAACAGATTAGTAACGCATCTGTTAAAAGTAGC
AGCGGAATTGATTAGCCCTTGTGGTATTACTAACTAATCCCAGAGCATACCGCTTGGGGTTCTCACCGCAGTAAATGGGATGCCCCTTTCGCTCATCACG
ATCTAATAGAAGCCATCCATCAGTTCCATTGATAAAAAGATGGTACTCTTTGCCATACTATCTATGATGACATCTTTTCTCGGTGTAGGCGTCTGAGCCG
GTACCGTCGCAGCATTCAACTTGTTGAATGAATGCATTATCCGCCATCCTCCTATGGATTTTTGCACAGAGAAGGTCGTAGAGCTTTGTGGGGAGGTTGA
CACCCTCACATGGCCCGCTGCTAAGCGATCTGCTAAGAAGTTGCCTATCGCTAGTACTTGTTCACGAGGCAGTGGTCACTACTTCATGACACAGTACTTC
AAGCCCGGTTTAAGCTCGGTTTCATGTCGATTGCCTTTGTCCTTAGGCAACTCGCATGGTACGGATTCAGAGAACACATCCTTGTATTTGATAAAAATTG
TATATAAAGGATTTTCCTGAAGCGACTCCCAAGATTAAAACGTGTGTCGTTCAATCCGATTCTTCTCATCGAGGACACTTTCTTCCATCGATGAGCTACT
GAGAACCCGTTCGTTCTCAGCAAAACTACTGCCAACCGAATGTCGGTCACGTACTCGTCCTCTGCGACGAGTACACAGATCTGCTTGACTTTGCCACTAA
GTAGATCTCGCAAGAACCGTTCTGGCGTTGGAAACTGAGGTATCTCCAAATTCAACTTCGGAGGCGCGATCATATCAAGTGTAAAAGCGCCTAAGCTTGA
TCCGTCATTAACCAAGACATTCAATGTCTCGGTTTCTTCCTGAGAACCTATTTCGACAGGCTTCTGGGAACTCATTTCCTCAGGCTGATGATGTATCTTT
ACCTCACCAATACCTGCTTGAGGAGTTTCTTCTTCAAGTACGTGGGGACTTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACATCCAGGTCCT
CTACGGTCGACTTTCCAGTCGACCTAGGATCATCGAAATGCCCTGAGTGGGCAACCGGTTTATTCTTCCTTGGATGTCACCCGCTAGGCGTACACCCATG
TCCCGATCCACTCGACTTGTTCGAGTGGTGGACCTTCGGCGCTGCCTGTGCATCCTCACAGCCGCCGGCAGCTTCCTCCAGAGTGTGATTGGTTGTCACA
CTGCAATCTTGTGCAGTCGTACTAACGACCGTACCACAAGTGAGGCCATCACAATCACTAGCAGTACATCCACACGCTTGTGGACGCTCCAAGACGTTCA
TCAGATGGCAATCTGATGAACAAGTGGCAGGCATTTTCACGGTTCGATGCTGCCATCTGACCCTTGGCTCGTTAATTCTGCGCCATGGTAACCCTAGGAC
GACATCAAATTTGTCATCCAAATATAGTACGATGAAATCATCATCTACTGCAAATCTTTCAGCGTGTAGTGAAGTCCCAATACACGTTTCATCAATGTTA
TCGATGCGCCGATTGCTAGGCGCACCACCATCCTCTTTGGAGGGTTTCGCGCTCAACGAACTTGAGCCTACTACCATTTAGCGACTGGCGACGAACAAAG
TTATTTAACGCCCTATAGTCAACTACGGCACGACGTGACAAATCTTCAGTCCCTTCCAAATTCTAGATGATGAGGGGTACCTCATCACCAAGTGCATAGG
CACACAATGATTTTGAGTCCGGAGAAACGTTCAACAAGTGATATGCAAATTCTCTTGAGGTTTCTGGATCAGTAGGGCACTCCACCCGTACTGACCGAGA
ACGGTTTTTACGATCGACTCCTTTGTTGCGATTTCGCCACATCGTTGGACCTGCTTCTGTTGCCCTTCTTGGCGAACGGTCGATCAGTTCGCTCAGTTTC
GAGACACTGGGCGTCGGTCACTACACTCGTAGGAGAAGTGTCCCTGTTTCTGATAGCGGTTGCACTTCTGCAACCGCTTGTTGTTTGAAGAGAGAGGTAT
TTCGCTCTCAACATAACCGAGGTCCATAGGTTCTGGACCTCCAAATTCTTGACGTCTTGGAGGACGATATAAACCCGAGATAGCATGAGCATGTCTCAAG
ATAAAGTCTTCCTTTTCCGCAACTGATATCTCGTCTTCCAGTGTATCCAGTTCCAAGCAGAACAGGTGAGTCTTGACGGGACCATCCTCAAGGCCCTGAA
TGAACACCGTAATGAACGTGTGTTCATGGACCGGGTTGGCCTTAATACAACTCGCAAGGAATTCGTATGTGTTGGGCGTAAGCGTGCACACCACGCTTAC
CTTGTTCAAGTATCAGGAGCTCTGCTCGAGCCCTGAACTCAGCCCGCGGCTGTTCAAACGTTTGTCTAAGCAGGGTCTTGAAGACCTCCAACGACCCAAA
CACTTATATGTCGTGCAACTTGAGACCTAGTGCCCAAGTTGTGGCACGTCGTGCCAAGTTCAACTGAGCGAATGCGACTTGCATTTGCCCACCAACGATA
TGACAAGCTCTTATAGACGTCGTCTAACTCGACGAACCAACTCAACAGGTAGTCTTCCTCGACTCCTCTGTACTTG