Description :
From Genome Similarity Track
Location :
Scaffold_86:20509- 26720
Sequence
6211 bases(100 bases per row)
TCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGTTTTTTTTCTCTTGGTGTTACATACCGGAATG
GCTGCTTCGGGGGTGGATTTAGGATCCCATCCATGTACCAAGTAAAATGGAGTATCGCCCCGGATCCTGTCTTGGGCGGTGTTCATTGCGAAGGTGAGTC
GTTCGGCGTACTCATCCCAATCCCGCTGATCCAAATCATGTGCATACATCTTGAGCGCCCTCGTGATCGTCTGTACCATACGCTCGGCCGATCCATTGGC
TTGGGGCGATATGCCATAGTTGCCCGCTGTCTCTGCCTCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCTGACTATGCCGAA
TCATCTCACTAGCTCCAAATCTCCGAAAAACACACTCCTCGTACGATTCGGCGATGGTTTGTGCAGTTCTGGACGCGCTAGCTTTGGCTATCACGTATCC
GGTAAACAGATCCACCCAGATCAACAACTCCGTGTTTCTTTGAATGACTTGGATAGTGAGGGGATGTGATCCATGGCTATGATTTGGAACGGGTAAGTCG
CTTGGATATTCCCTGGAGACTCCCCTTCGATTGTGGGCCTGCCCTGGCCCATCTCACAATCCACGCATTCACCGACATATCGCTGCACACTCTTGAATAG
TCCCCTCCAGTGGAAACATTCCCGGATCCACTGGTAGGTCTGACCGATTCCCTGATGTCCACCTTCTAAGCTAGCGTGATAGTGATGAAGGACATCCTGT
TGCAAGGTTTCCGGCATCACCAATCTCATCAAATCCGTCTCGATCCCCGCTGACTCGTTTCGTAGGGGGACAATAGAAGAGCAAACCATTCAGATCCACT
GCATAATCCGTAGCGATAGTACTGTAGGATTTGACGTCCTCCCGGTTCAGGTCTCGTACATCCCCATCAAATATTTCTTAAGTCCCAGGATCCACACTTC
TTCGCTTTGTGCTTTGAGAATCCGCTCAATACGGACTCCCTTCACAAATGCTTCATCGAGTACCTGGGCGCTGGATCCAATCCTTCCTCTGGATCTAGTG
ACCGCCGTTACCTGGACCGTCCTCCTCACAGATCCAATCACCACCACTTCGTTTAGTCGGTTTAGCGTGACGAGATCCTGACGCTCGGCCTCCCTCTCCA
CCTCAACGCCACATTGATTTCGTAAAGCGGCACTAGCCAAGCTGTCCGCACTGGCATTCCAATCTCGCTTGACATGTACCAGCTCGTGATTCATCCAACC
ACGTAAGTGGACCATCCCCTTCTGCCGTAACAGCGTTTCGGCCGGGGTCTTGCAGTCAATTTCGCCTCGCACTTGTCTGATCACCAAATTTGAATCCCCA
CAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAGATCCAAACCCAGTAGGAGCCCGCTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAG
TGGATCTGGCCCGTACAACTTCCCATCCAGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGCACGCGAGCAGATCCATCAAAACTCAG
GACGTACAGATCTTCATCCACTTGTACCGTCGGGATCGAGATCTGGATCCGGCGTCTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGTGCTTCGTCCATC
TTGGCTCTGGGTGTGATGCTCGCGGCCAGAACTCCCAGGATCGCGTCTTCTCGCTTCGAACATTTCACGATCTCCAGTGTCCACGGTGAAAGTAGAGCTG
CCCATTGTCCCAACCGTCCTAGTAGACCGGCCGACTTGAACAGCCAGGCGAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTT
ATAATTGAGATCCAACACCCGCAGGAGTGCGAGTATCTCCTTTTCGCTCCGTAATTCAGCTCGTTCGGTTTTAGCGCTCGGCTGACGAATGTGACCGGAT
GGCAGGTTCTTGTACCAAAGCCGCTGAGACCGCCCAATCACTGGCATAGACTATCACCATAGGTTGACGTTCCGGAACGAAATTGCGGAGGATGGGCGTC
GTCGCGATCATATTCCTTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGCTCTCCTCCGTCAACTCTGTCCAGATTG
GATCCCCTCGCCGTTGGTCCCGTGATGGATCCAGTTCCTGTTTTAGGTCGTTTTCCGGCGTCGTACTACGTGGATTCTCTCGTGGATCTGGGAGCTCTAG
GGCCAGAGCTTGTTGGATTTTGATCCGGACAGTCGAAGTGGCCATCGCAGCAAAATCCACCTCCCTCAATTCATAGAGTACTGCAGCAAACAGTGCGTAA
TTCTCGATGAACCGACTGTAGTAGTTCAAACTACCCAAGAAGGATTGCATCGCCCGTAGCAACTGTAGGAAGGACAAGTCTGCTAACGAAGACAGGTCCT
TAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGACCTAAGTAATCCACCTTGCGCATCCCCCTATAGCTCTTCACCACGCTGATAGAGAGATTCCA
CTTAGGACACGCCTCCAGTAGGGATGTCACTCTCTCGCACAGCTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATAGGATATGCGCCCTAGC
ACGGATGGTGTCCCCAGATCATCTGGTTCTCCTGCTTCGAATGGATCCACTTCCACATGACCTTCCTCGGATCCATCCCCTTCGAGTCCGGTATTCCGGT
AAATCCGTAGAGGGCATTATCGATCAGGCGTTGATAAATCTGGGGTGCATTCTTCAATCCAAACGGCATCCGGTTCCATTCAAACAGTCCAAACGGTGTG
ATGAATTTATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATATCTAGAGAACAGTACCAGAGTACTTTATCTAAATCCTCCAA
TAGCTCATTGATTAGAGGCATCGGGTACACCATCAGTCTGGTCAGGCCGTTAACCATCCGGTAATCAATACACAGACATATATCCACTCCGTTCTTCTTA
ACGATGATTACCACAGAAGATGCCCACGGGGACGTTGAGAAACTGATGATTTTGGCTTGCAGCAGGCCCTTAATCAGATTCAATAGCTTTTCTCGGAGCC
GAGGCGCCATCTTCCGCACCATTTGAGCGATCGGCTTCGCGTCACCGACATCGATGTCACATTTGACTCCGTGTGCAGCTGGTGGTAATGCATTCCCTTT
GCCAATTAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGCCGATCCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGATGTCGTCAATCGTA
ACTACTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCGAGATCCTCGGCGTGTAGATCCTCGCCTTCATGGTAACAGACTTGTTCATC
TTCAGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACTCTCCTTCACCCGTCATTCCTTCTGTCTTCTGGGATCGGGTATCCTGGTACCGGGGA
AGCTACCTGTTGGATCGACTTGGTCTTCTGGTGAGTTTACACACGACGGTTCCTGTTTGGCTAGTGTTGCCACTCTCGGCAAGGATCCAGGCACTTTGTC
CAATGGAAAACTCGGATCCACTTGTGGGTCAGCAGGATCCGGCGACCCGGCTTCAGTTCTCTGCGATCCCCCATCCACCGACTCTGGGTTATCTAGGGAC
CGGCCCTGGGCATTATCTTCGGTCTTGGATCCAACCTCTATCGCTTGGATCTCAATCCGACGATCCCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAG
GCCGATCCACCAAGGGGCCAGTTGGTTCCGCCGGGAGCTCCACCTCCGCGAGGGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCT
GTAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGCCAACCATCGCCCAACCTCCTCATAATGGTCCAGTAATAGTCTC
TTGTCGCTGACATTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGGTACCCACTTCTCACCCCGAGTGACCTACAGTTTCTCAT
GTTCCACCCACTTCAACCGATATGGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTCGTCTTATTTGCCCTTATGATCATCATCTTCGCCCCGTACAA
CGGTCGCCGTTCGTTGAGCTAGATCCGCATCTCGTCCGGGAAACACAGTGTCCCATCCGCCAGATCCAACCTTACCCCGGCTGGTACCATGAAATCCATC
CCGAGGATGGCGTCTTGACCAGCGAGATCTCCGACCCAAATATCGAACCAGTATACCAAACAAACTGCCAGTGTGATCTTGATCCGCGTTCTCCCATTCG
TACGGTAGAATTCTTCACCAATCCCAACACAATCTTGGATCTGACGCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGAATAGACAC
CTCGGCACCACTATCTAGGAGTAGGATTATTTTTCATTGTTGATCTTGCCCCTTACCTTGGCCTGTCTGAACCATTTTCCTGGGGCATGGTACTTCCAGT
ATCCACAGGACTCCCCTGTCAGCAGATCCATGGATCCAACATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTAGGTGGATCTGCAGTGACCTC
ACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCGCGCGTTTCTCCCCTCTGTAGATCCAATGTTGAAGGGACTTCGGATCTG
GCGAATTCATCCACTTGGCGCCAACTAGAAACCTTGGCAGCTGACAGTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGAT
CTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGG
CCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAACTCTTCCATCGGGCACTTGCCGACGTCATGAATCTC
GCCACAACCGCGACACACGTGGAAGCAATGACCTCCGGGATGACCCTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAACATCCAGACTCTGTGTGC
TTCCGGGATCCGCACTGCGAGCACCTGATTTGTCCTGTCCCGTTCATGCGATCTCGGGATCTGTACATCCCACGGTTCCCGGGTACGGTATCCCCCGACC
GCGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGATGCAGTGATACAGACTCGGCGATAATTCTCTGGGTCGGAGTCCGATCCATCGGATCCCAATTC
CGTTCCTGAGTCGGGCGCCGCGACTTAGTGGACGCGTCGAGCTGGAGCCGTGGGCGTCGGATCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTGC
TTCTGGCGGTGTTTCGCGCGATCCACAGCCCGTAATACTTCTTCAAGTCCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTATCGGCCAGATCCACAT
CTCCCAAAGTTTCGATGAAATGATCCACGTGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCACTTGGGCCCGTAGACCGGCCACATTTAGACG
ATGTAGATACTCCAGCGGGGATTCATCCGATCTGCGGTGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTG
CGCAGCAAATCTGGCCACTTGTTCCTGATGGATCTGCCCAGCTGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTTTAGGCATCCGA
CGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATG
GCTGAGATCCGTACCCTCTGGACCATGGACGATCCACCTGCCCCGGCTGCGGCTGTTGCTATCGCCGCTGATGAAGGGGATGGGCCATCCAGATCATCTG
GGTCGAACTCA