Description :
From Genome Similarity Track
Location :
Scaffold_39:20507- 21539
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_39-snap-gene-0.47HECT E3 ubiquitin ligase

Sequence
1032 bases(100 bases per row)
GTCTCCGTCGATCTCCTGGCAGTTGTAGATGGCGTACCGCAGCTTGTCGCGCACCACGGTCTCGTTCGTGTACGCGGGCAGCTCGAGCGCGAAGAAGCAC
GTGTGCGAGACGGGAAGGAAGTCGTCGATGCCGCGACGGCGTCCGGCCGCCGACCCCGACGCCGCCGGCACGCTGAACGACTGGAGCTTGAAGCGCTGCG
GGAACTCCTTCTCGTGCGCCGGAAGCCGCGCGCGGCCCCACACGAAGCGCAGGAACGCGCTGCGCTCCTCGTGCGAGAAGTCGCCGAGCACGCTCCAGAA
CCACTCGACGTGCTGGTCGTGCGGCGAACAGCCCGAGTACTCGGTGCAGCGCCGCAGCAGCTCCACGTCCATCTCGGGCGTGCCGCACACCATGACCTCG
AGCTCGGCGCCAGTGAAGAGCGCAAGTAGCTTGGCCGGCACGACCTTGGCGAGCCCTCGACGCACGCACGCCGCAGCCGCGTCACCCTCGTGCAGCCGGT
ACTGCTCCACCAGGTCGGCGTACTGGCTGCGGGTCGCGAACGTGACGGCTCTCGAGGCGCCGCCAGGAAGCAGCTCCACGGCGCGGTTGTCGGCCGAGAG
CGTCGTGAAGACTTCCATCACGATGTCCTCGAACAGCTCCTCCGTCACACCAAGCCGGTCGATCGTGCGCATCTTGCGCATCGAGTTGACCACCATCGAG
TCAGCCTGCGCCAGGTCGTCCAGCGTCACGCGCTCGCCCACCAGCGGCTTCCACACGAGCGCTGCCAGGTGCAGCGACAGGTAGTGCTTGCTGCGCATGG
AGGCACCAAGCAGCTTGCCGAGGAACTCGAGCAATTGCGCCATCGTGGGCGACGCCAGCGGCGCGCCGGGGTTCAACACCCACCGGTCGCGACCCGCGCC
AACGTTGTGCTGCGCATTCGAGCTCGGCAGCAGCAGCGGCAGCTGCGCGCTCTCGAGCTCGTCGCAGTACTGGGTCAGCGTCTCGCGGTACGGCCCACCC
GCATCCTGCGCGTTCTCGCCCAAAAACGTCAC