Description :
From Genome Similarity Track
Location :
Scaffold_33:205068- 208398
Transcript NameFunction/comments
Phyci_308539Hypothetical protein
Phyci_92424calcineurin-like phosphoesterase, putative
Phyci_273752Hypothetical protein

Sequence
3330 bases(100 bases per row)
CTTCTCGACTGGTTTGCGTGCCTTGAAGTGGTATTTCTCGATTGTCAGGTGCATGATCTTCGAGAACACGTAATTGGTGTGATAGTTGCTATTGCACCCA
TTTCTATGATGCTCATCTGGTCAATGTTGGGGCGAATTTATGGCGGCACAAGCTTCACCATCCTGGCGTATGAGAATCACAATAGCCACTTCAACCTAAG
CGCCTTGGATGTCATGGGTAATGGGCTCGTGACGCTCGTACTATTGTTTATAAAAATCGGCTACCGAAAGCGTGAAGCTCTACGCTCAGATTTCAATACT
GTTCGTGTTGACTGTGCTATCATACGAGTAGGACTCAAAATGGAAATGATTTCGGTGAAAAAGCCTCGGTCTCGACGCCAATCGCATGACGAGGGGATTG
GGAGATCGGCATTACGCACAGCACCTACCCAGACAATAAGTGCAACGCCCCCTCCAGCTTGTCCCAGAATTATCCAGAAGTTTGGGTTTGTCAAGGTCAA
CCAGACTTTTGCTTCTAACCAAATAGTTTTCCCGATAAGAGCTTCTGCGGGTGTGCGAATTCCAGCGCTTCGACTTTTCATCCTTTACGCCGTTGGAGTC
ACTGGATTGCTACTCTCGTGCGCGGTCATTGTGTTGGAATGGGGCCCTGCGGTGTCAAGCATGAGCAGCGACCAACATGTGCAAGCTTGTGCGTGGGTAT
CTCTAGTTTGCACAATACTTTTTGCCGCGCCTTTTGTCACTCTGTTCCACCGTAAACTTCTCCAAACACTGGTCTTCTCCTTTGACTTTGCATTCTACAG
CTTCCAGATCACCTCAGCTAATCTTTGCGTGGCTAGCTTATATCGATGGAATTCATCTCACAATATTCTAATGTTAGTGTGGTGGATCTGGGCTCACTGG
GCCCTAACGACGGATGCATTGACACCAATCATGCGAGAGAAGCTTCGTCTCAGAATCTGCTATGCTGCGCCAGTCATCGCCATACTTCTCATTATTCACG
TTGCTGTCGTTGCCAGCATCTTCTTCATCCAAAACGTTAATTTACCCGACGTCATCGTATGGGAGGGAACGGTCTGGAAACGCTACGTGAAAGTGTCCGT
ACTTCCGTACTACTTCAGCCGTGTTGCCACGTTGCTGATTTGGTGCTTGCGCTTAGTGTGGCGTCTATCCAGAGCGTCTGACGTGGACATGACGCTTATC
CGAGCTGCTGCCAGTTATGAAAACTGTTTCCTCGACGTTGAACGAGACCGTTCTAGACAACCGCTCTCTGCGTCTTCATCAAGGCTCATTGCTATACCTC
CCCGCATCTCCCCAGCAGAAATATCTCAGTGAACAGCGAGTTTCTTCCATTTTCGGGAAACTGTTCTTCCTTTTTCATGAAAAGCACTTGACTTCTACTA
CGATAACGCATATGTGTGCCAAAATCCGGGAAAACATTTGTCGAAAACTATCCAAACACATATATGTATCAAATCAGCACGAAAAAGTCTCAGAATCAAT
GCTGGGGCTGGCGATCACGGCGCTGCTGGCCGCGCCGGCGTCCGCGGCGTCCGTGGGGCGCATCCTGCACTTCTCGGACGTGCACCTCAACATCTCCGAG
TCCTTCTCCGCCACCGCCAGCGCGCGCATCCCCATCCGCTACTTCGCCGACGCGCCGCTACCGCTGCTCGAGTCGGCGCTGCTGTTCGCCAAGGAGCACG
TGGTGGAGGACCCGCAGCTCTTCCTCTACACGGGGGACCACGCGGCGCACGGGCAGTTCACGGACGAGTACATCGCCAAGGCTGTGGAGACCAATGTGCA
CGCCATGGAGAACTACTATCCGCCGAAGGGGCAGATGCTGGAAACCACCGCCGTCATCGGCAACGCCGACGGGAGTAAGGAACATATTCATGTGGTTATA
GAGAGAGAAACAAGTAGTAGTATAGTGCTAATTCTTTGTTGGGGCAGACCCCGACTATCATATGGAGGTGACCGACCCGGAGAAGGAGACGAACCCGTCC
ATTGAGACCATCTCGGCGGTGTGGAAGGACTCACTGTCTTCTGCCAATATGGACCTGCTGAATCGCCGAGGGTATCTGAGTTACGCCCTAGACGACAAGT
TGAGCGTGATCACGCTGAATACGGTGCCATACTCGGTAGGTGTGTATGGAGCTGCATGGGCGAAAGTTGAGCGGGGTAGTTGGTACTGACGCGGTTTGTG
GCTACTGTAGCCGAGTCATTTGCCCGATACGTCGCACGAACCGGACCCGTTCGGCCAGTTTGCCTGGCTAGACCAGATCCTTGCTGAGATGCAGAGCGCT
GGGAAGTTTGCGTACATTTCGGGGCATATTGCGCCGATTGTGGACTCGTACGGAGGCAACCCGCAGTGGCATACCAAGTACATCGCCCAGTACAAGCAGA
TTGTTGGTAAGTATGCCGACGTGATCAAGGCGCAGTTCTTCGGTCACATACACAGTGTCGAGTTCCGTGTACCTGTGGCAGCGCTTGATAGAGAAGACAA
TGCCTTCCAGCTGCTGCCGATGTACATCACGGGCTcaatctcgcccctgttcggcaacaatccttcgttcatggtctgggagtacgacaccgagacgtac
gagatcctcgaCTACGCTGTGTATGCATCCGATATCGCCGAAACCGAGCCGCAGCTCGACTGGAAGCTTCTGTTCAAGGCGAGCGACGCGTATGGTCTCA
AGGCGCTATCACTGACTGAGCTTACGGCTTTTGTGCAGCGTGCAGAGCAGAACATGAGCTTGGTGGAGGACTACTACTGGAATATGAAGGCCCGTTCGCC
CAACGCTCGACCCTGCAAGGACGCTGCCTGCCACGCCAAGACGCTGTGCACGCTCAAGTGGTGGACGACGAAGGGTGAGTACCTAGCCTGTGTCGACACT
GTCCAGACGATGGCTAGTGCGCGAGTGTATGAAAGCAACCACACCCCTGCTTCACCCGTTCAAGCAGTCGCCGCAGCTTCGTCCGGTTCCAGCTCCGCGC
AGAACGATCTGGCGACGAAAGACGTGTACATGATGATCGGAGCGACGGCTCTTGCCACCATCGTCGCAGTGGCATGCGTTGCGATCACTGTCTACGCTCT
AAGGCGCACTGGTATCCTCAAAAACCGTGCGCAGTACGATACTGTAGCAACCCTCTAGTTGGCCGTTTGTCCTGCGCCTGCCATCACCACAGAGCGTGAA
CGACATCATAAATTTTTGCCCGCCCAATGACGCTCAGCTGTTAAGACCCGTTATCCTCAATTGTGCCATGTACTTGATCCGAGCATCTACGCCGACGCTC
ACATCAGCTTGAGGTGGCCCGTGATCTCGT