Description :
From Genome Similarity Track
Location :
Scaffold_90:205035- 208406
Transcript NameFunction/comments
Physo_140839PREDICTED: similar to Myb proto-oncogene protein (C-myb)
Physo_140840paired amphipathic helix (PAH) containing protein

Sequence
3371 bases(100 bases per row)
CTAACAAGTCGTCGCTCTTGAACGTACCCGCAGAATTGCAGAGTACGGCATACGACACTCTGCGGTTTGTACTGGAGCGCGTCGAAATCGAGGCCAAGAA
CGAGCACTGCGACCAGCGCCTCAAGATCGATTTGCTGCGTGACATTTTGCGCCACAAACAACCAGGTACTTCCCCACCTTGAACGATCCACCTCTCCGAT
TCGAGTTCACTGAACCAACAACCTGTTCCGCAGTGATCCAGGGGGACAAGCAGTTGTCAGATCTGTCGTCAGTCTCCAGTGCGAATGGGCGGGGTGCCTC
TGCTGAGCGTACCTCCTCTTCGTATGATTCCGGTCGAGCACAATCTCCTGCTGGGACTTCCACCGCTGGAGTTCCATCCCGCGTCATGTCACTTCCGTCG
GTAGTATTGAGGCACGTCGCTGCCAATGCGGAGGACAAAAAGCTGCGAGCTCGCAACCAAATCGGCAATTTCGCCGCCATCTCCGGTGAGGACGTCGTTG
AACCCGTCGAGAGCCCAACACGGATGACTCGGCAACAACGGAAGGCAGCGCGGGCCTTCGCGAACTTGCAACACCCCGTTGCTGGCAAGAGTCTCGGAGA
CTACGTGCAGATGCCTGTCAAAACTACCATTGTTGATACACTCGCCGCAGATCAGCCCACGAAGCCGGCCTCGGACGATCTTCTCTTCCTGTTCCCCACT
GTAACCAAGCGCCGACAACTCCACGGGAAGTACGTACCGTACCAACGCCGTTTGCTTATCGTCACTGACACGATTGCATGGTGATGGCAGAACACTACCC
TTGCTACCCAGGTATCGAGGCTATGACGCCGTCCCAGCAGAATAGGCCTGTAAGTGCACGCGACAGCGGAACCACAAGCACAAACGCGCGCTGTTACTGG
GCAAGCATACATGAATTACCGAACACAAGTACCAATCTTCGCAGCGGCGTCTCACTCTGCCTTCACATCCTCAGTAGTCCGATCGACCTTTTCTTGATCC
CGTTAATCCTTCCTCTTGTCATCACTCGTTCCCGATAAAGACACGATATTTGACGCGTGAGTCTTCACATCACCTGTAGAAGCAGCAGAGGGCGCAGCCG
CAGAACTGCCACTAGGTCGCTCGGACTTGACATTGTCGAGAGCTGGCGCCTGCTGCTCCTTGGGCTTATCCACTGTCTGCCTCTCGACCTCCACTCTCTG
TTCCCGTTCTTGAGTCTGCTCCTGCGTCTTCTCTAGCTTCACTTCCTGAGTGTTGAATTGCGTGGATGAAGCAGAGGCAACCGGCTTCTCGTTTCCTCCA
GTCATCGGGTCATCCTCCTGAGAAGCACGTGCAGACGACTGGACAGTATCAGCAGAACTCTCAGCATTCGACGCCTCGGCCTCAGTCTTCGCCTTCTTTG
CCGCAACTGATACCTCCGCAGCCGTGGAAGATGTAGATGGAGAAGTCTCTGACACAGCACCCTCCTCATCATCTGAATCGCGGGCGCGCTTCTTCAGCAA
AGTTGCTGACTCCAAGGCCTTCGCCGCGCTGGCGGCGCGCGCATCATCTGACGAGGCGCTGGCGCTATCGCTCTGCTCGACACTTCCAGACGATGCTGGT
GTTGAAATCTCCTTCTTGACATCGTCGTCTTCCTTGGATTCTTCCATTGGTTCATCGTCGTCGTCATCCTGCGACTCGTGCACAGGTGTGTCATGCACGG
GCGAGCCGTACATGGGTGTTGCCGACGGCGTGTCCATCGGCGTGGCACTCGGCGATTCATCATCGTCATCATCGTCGTCGTCATCTCCATCGTCGTCCAT
AGAACCCAAGTACTCGATCGCTAGTTCCGGTTCAATAAGCCACTTGCTGGATTCAGGGGCCTTCACGCGCGGCGATGGAGCCCAAATCTTGAAGGGTTCA
GACGCTCCCGATGGCGTGGTGCCGCCACGGGCCTCCAGAGGAGTCTTGCGCAGCACACCAGGGTTAAACTCGATGCGGAACGCACCTTCGCCTTCGAAAA
TGGACTTGGTCTTGTTGAGGTACGCCGTCGCCTTGGCTTCAGCACCTGCGGGGTCCGTCGACGGCTTAGGCTCACCCTGTACCTCGGTAAACGCCTTGGT
AAGCTCTTGGCAGGTATCATCGTTCGCGAGATGTTGCATCTGCTTGAGAACCAGGGTCACCAGCTTGTCCATAGTGAACAAGAAGTACGACGTCGATCCC
ATGAGGCTACGGCAGGAGTCCTCGTACTTGGAGTTGTCAACCGATCCGTCAATCAGCGAATACAGCTTCGAAACAAACGCCTGGTAGTCGCCGGTCTTTT
CCTTGGTCGATGCTGACAGCGAGTGGTGGGCGTGAGCCAGTGCGCGCGCTGCAGGGTTAATCGTGCGCCGGTTGCGGTTGCGCTTTGCCTTTTCGCACAG
GTCGAACGCACGCTCAAGTCGGTTGTGCAGCACCTGGTACAAACGCAGGAACGCATAGGCGTGCTGGTTGCCGTAGAATAGAGACTTGTAGTCGGCCTTC
ACCTTGGCGGCATCCTGCTTGCTGTCCAGCGCAGGAAGACCAGGCGGGAAATCTGCGGCTTCTTGGATGGTGAGAGCACCAGGCTGCAAGTACGCCTGGC
ACCCGATTGCAGCCAGGTTAATCGTGAAGTAGCCCTTCTCCTTGTTGTATTGCTGCACAGTTCCCTCACCAAACTCCGTGCTCACTTCAGTACCAACGGA
AAGGGTCTTCGCCTTTTCCAGCGTGACCGTAGTGCGCTGTGGCTTGCGCACAAGCCACTCTTCCTCCAGGTGGAAAAACGGGAAGAAGAACGCCTGCCAC
ACCTTGGAGATCTTCTCCTTATCCGCCACGCTCAGATTCTTCTCAGCAGCGTACGACAGCAATCCAAACGCCTCCTTGTGGATCTGAACTGACGCGAACT
TGTACACAAAGTGGGGCTTCCACTTGCCCGAGGATACAGGCTGCGACAACGCCGCCGCAACCTTGCCATCTGCAGCCGGAATCTTAGCTGCAGCAGAGGA
TTGCTCCTTCCGAAGCGCATCAGCGATATCTGACGCCTGCGGAGGGGCCTTTGCGCTGACTACTTCGGCCGTGGCTGAAACAGTAGACGGTGACGCACTT
GACTCCGTCGTTTTGGCTTCTTCAATGCGCTTCTCGTCAGCCTCGAGCTTCTTTTTAGCTTCTTGCATCATCATCTTCATACTCGTCTGCTTCTTGTCCT
TCTGCTTAAAGTAGAAGCTAGAGTGATCCAGGGACTTGTGGTAGTTCTTCTCGTTCACCTCCTTCCACTGGCGGTTAAGATCTTCGCGTGCGCGACGCCA
TTCTTCGTCCTTCTGCTTAAGGCGTTTGAGGATCACGGGAATCGCTCCCGCCGGGTACTTACGCAGCAAGT