Description :
From Genome Similarity Track
Location :
Scaffold_299:2050198- 2052527
Transcript NameFunction/comments
Aphin_H310_03061Hypothetical protein

Sequence
2329 bases(100 bases per row)
GACGACAAGGTGGGCCGCCCCGCCGGCGTCGGCGGGCTACGTAAAGAAAACTCGGGCATCACAGACGAGCTGTTCCCGCTTATCGAGACGGCACGCCACC
ACTTCAACGAGCTCATGGCGACCGTGGCCGAATGGGACTTTGACGTATTTCGCGTGCAAGGTAACTAGCTCGATAACGCTTGCTTTCTACGCGCTTCCAA
CGGCACTTGGTCTCGGATGTAGAGATCACCAAAGGCAACGCGTTGACGCACATGGGGTACTTTTTACTCCGTGATTTGGTTGAGGAGCACCTCTTGTTGG
ATGCGCACACGCTGGCCGTGTTTTTGATCGAAATCCAGCAAGGCTACGTTGTCTTGAACCCGTACCACAACGCGATGCACGCCGCGGATGTGATGCAAAC
GTCCAACTACTTTGCCACGCGCAGCGCGATCGCGCCGTTCTTGCGACCGCTCGATCGGACGCTCGTGCTCCTCGCCGCGTGCATCCACGACTACAAACAC
GACGGGTTCAACAACGGGTTCCACATCGCATCGGGTACGTCGGGTTTTGCAGCTCCGTGTCGAGGTCACTTCTGTCGACTGGGCTCGGGCTCCTACCTGA
CTCTGTTCGGCTGCCTCGAGTCGAACGAAGGCTCACGTATATCAAATAGGCTCGGAGCTCGCGATTCGGTACAACGACACAGCAGTGCTGGAAAACTTTC
ACGTGGCACAAGCGTTCTTGACCATGAAGAGTTCCAACTGCATGCTCTTTAGCAAGTTGAGCACGGACGACTACAAGTACGTTCCCGACTGAGCGACTGT
GCACACATGTTTCTACGCGTCGAGGTCGGGGATTTGTGTACTGACTAGGGCGTGCGCGTGCATAGGTACAGCCGCGACATGTTGATTCAGCTCGTGCTGG
GCACAGACATGGCCAAACACTTTGAAGATGTTGCGCTGTTCAAAGCAAACATCATGCCCCAGTCGCTGGACGAACGGTTGGAGATCAAGACTCTCGGGTA
CGTCTGCGTTCGACGTCGCCCTTGAATTCCTTTTCCCCACATGTCAACTGCATTCTAGCGACAAGAAGATGCTCATGAAAATGATCATCCACACATCGGA
CGTGTCGAACCCGGCCAAAGTCCGCGTGACGATGCTGAGGTGGACGGACCGCGTCGTCGAAGAGTTTTTCGGCCAGGGGGACAAAGAAAAGACCCTCGGG
CTCGTGGTGTCGCCGTTCATGGACCGCACGACGCTCGCCCTCAAGAAGATGCAGCTCGGGTTTGCCGACTTTGTCGTGAGCCCGCTCTTCCACGTGTGGG
CCAACATCTCGCATCAAGTCCAGGTCGACGGGTACACGACGCTGCTCGACAATCGCGAGTGGTGGAACCAGCGGGACGACAACTTTAAGCACGCGCAGAT
CAAGGGCGTGGTGAAGGACTTGCTGCAGGATGCGACCGTCGCGTCAGGCCTCCTCTCGAGGAAACTCTCGACGGGGTCGCTACCCATGGTACGGGAAGGC
GACGGCCGCGCGCCTGCATCGCAAGCCGAATCGGACGGCGGCGGGTCGAACAAGCTCGAACTCGTGGTGAAGGAGACCAACAAAGGGGGCGGGACCTCCG
ACGGACCGACATCTACCACGGCACCGTAGACCGTCCATGAATAGGATGCCAAGTGTGAATAGAACGACAAGCAGCGGGTAGGATGATAATCTCGAAAGAG
TACATTTGCGGCATGACGGCTTGTTCGTGCCACAGCAAACTGCACACACCAGGAACTGTCCGATCGCGTCGTTTACGAGACTGCGCTCGACATGACGGGT
GCAGAGAACACCGCCGCCCAAGCGCTGTGGAGAGTTGCTGCGTTGGGATTGCAAACTCGAATTGTTTTCAGTCGGATCCTGTCCTGGAGTCGGTCGCGAA
ACGAAGTGGAATGCTTCGACCACATACTCTTGGATTCGAAACAATGCGAGGGCAGCCAGGTCGTTCGAAGAACTGGTGGGGGGGGTCGACCATCTAGGAA
TCCCATGACTCATGCAAGCGCGCCAACGAAGCAAGCACGACAAGAGGTTGCAATGTGGCACCGTGTGGCCATTGCCCCGGGAGTGGAATAGCACATTTCG
TTGACTATCCTAGCACACGCACATGACACCGGGCGGAGGAGGGTCCGTGAACATTCCAAATTCGTACAAGCCGACGAGAAGGAGCTGGGCATCCAAGGGT
TGTCGACCCGTATGAACGAGCTCATGAGGGAAAGGCGGACGAGGTACTGATGCATCGGTCGGGTCGGAGCAATGGGGGGCAGGGCTGCAGATGCATTGAG
TGTCTGTGCGTGGCCGAAGGGTTGGTTCG