Description :
From Genome Similarity Track
Location :
Scaffold_1256:2050- 9072
Transcript NameFunction/comments
Phyag_g10069nucleolin, putative
Phyag_g10070hypothetical protein PHYSODRAFT_468736
Phyag_g10071conserved hypothetical protein
Phyag_g10072hypothetical protein

Sequence
7022 bases(100 bases per row)
tgccTGCTCAGAAGGTCGCTGCtaagaaggaggagagctCCGACTCGAGTTCCAGCGACTCTtctgatgacgaggaggctCCCAAGAAGGCTGCCACGCC
TTCCAAGAAGcctgctgccaagaaggaAGAGAGCTCGGACTCCTCTTCggactcgtcgtcggacgaggaggagccgaagaagaaggccaccCCTGTCAAG
AAGGTCGTCGCtaagaaggaggagagctCCGActcgagctcaagctcgGACTcttcggacgacgaggaggagcctaagaaggctgctgctcctgctaAGA
AGGTGGCTGCtaagaaggaggaggactccgacagctcgtcgtcggacTCTtcggatgacgaggaggaggctgaaaaacctgctgccaagaagatTGCTGC
AAAGAAGGAGgagtcttcgtcgtcgtcgagcgactcctcctcgtccgaagacgaggaggaaacCACCATTGTCTCCAAGAAGCGTAAGAACTCGGACGCT
GGCGAGAAGTCCAACAAGGTGCACAAGCAGGAGAACggcgacgccgctgctgttaCCAACCCGCAGAAGACTCTGGAGATCTTCATTGCTGGTCTGCCGT
GGTCCgccacggaggaggaggtgaaggagcacTTTGCCGGCTGCGGCGAGgtcactgctgctcgcaTTCCTCTGCAGAACGGCCGTTCGTCTGGTACGGC
GTTCGTGACGTTCTCGACCCCCGAGGGTGCTGAGGCTGCTCTTGCCATGGATGGCCAGGACTTCGGTGGCCGCTGGATGAAGATCCGCacggccgagaag
aagaacatgttcgacgagaagcccGAGGGATGCACGAGCGTGTTCATTGGTAACCTTGCCTGggatgtggacgagaacATCATTCGTGAGTTTTTCGGCG
AGTGCGGTGAGATCCTGAGCTGCCGTCTGGCGACCGACCGTGAGACGGGCGAGTTCCGTGGCTTCGGACACATCGACTTTGCCACCACGGAGGCTGTCGA
CGAGGCTGTCAAGCTCGCTGGCGAGTACGTGAACGGCCGTGGCATCCGCGTGAACTACGCCAAGTCCCGTGACCAGaacggcggtggtggccgtggtggc
GGCTTCGGCGGccgtggcggtggccgcgGAGGACGTGGGGGCCGTGGAGGCTTTGACGGTGGTCGTGGCGGAGGCCGTGGCTttggaggacgtggcggcg
gccgtgGTTTCGGTGGACGCGGAGGAGGCCGTGGGGGACGTGGAGGCCGCGGTGGCCGCGGTGACGGCCCACCCAAGCGCCAGTCTTCGTCCATCCAGAA
CTTCCAGGGTTCCAAGATGACTTTCGACTAATTTAATGGTGGCTGCTTCGACTGGGGCAACCTTCACATAGGCCAGGGATACGATCGCAGGGAGACACTT
GCGCTTAGAGTGCCAGGCAATGGTGCTTGACTCGGTAGAGGTGCCAGCGCAGATGCAGCCCCCTGTCGTGTATTGACTAGTTTTTTGCATTGCTTTGAGC
TTCAATCGATTGTTTACATAGACTCCAACACGTTTTTCGGTTGTTGTTGCATGGGCTCATATATTGCATGACAGTTCCGACGTTCTACGATCAGCACGCG
AAATAATGCTCTAACCATTGTTCCATGGTACTTCCACCGTATCAGGGGCGTCTGCTAGAGCTGCGGTGGCGGCTAGAGCTTCGTTCTGCACTCCAACTCC
GACTTCGCCTTGAATGCCGTGACGAACGATATTTGTGAGACTTTCGCTCTTTCCGTTCCtttttgtccttcttgtttttcttctccttATCATCACGCGA
GCGGTGCCTGTggtgcttcttgtgcttcttgtgctttcGCTTATCCTCCCTTGCTTGCCGTTTGGCATCCCCACTCTTGATTCCATCAGCACTCCGCGAC
CGCTTTCTGTCACGACTTTCTTCATCGTTGGTTTGCTCCGAAGCGGGGGGAAGTGAAAAAGTGTTTTCGTCATCGGACGATACACTAGACTCGTCGGAGC
TTGCAGCATGACGATCTCGTTGGGCAACATTTTGGATTGGCTTTCCAACACCGTGTACCCGTACGTCGGGATTCAGTTGCTCCTGTTTACCCGGCAGGtc
tggttgttgttgttcttcgtcatcatcactttCATTTTCATTGTCAGCTTCACTTATATCAGATTCGTCCGAAGGGTCAAAAATGGACTTGAGCAGACTG
GCTGAAGTTTTCTCCGCTGCAGGCAAGGGTGGTAGAtctccatcctcttcttcgagttTGGTCTCACCAACTGCGCTGGGTTTGGAAACTTGGTGCCCCT
TTCCACCAGGTGGTCGCAGTGCGGCTCGGTCGGCGGCGAATTCCACAATGTGTGGGACAAGCTCCTCGTCAAACAAGTCTCGCCTCTtatcatcgtcatc
gttCTTTCCACTAGACCCTGTGGGCCCAGCACACTTCACATGAAAACGTTTGCAGAGCAGCGCTTTAGGAATCCACAAACTCTGAGACCGGTGTGACAAC
TTTGCTCGAGGTTCCTCGTTCTGAGCAGCCTCGCTTTTCCCCTCATCAGCTGTGGATTTTGACGAAACGAATCGTTTTGCAATCGATGCAGAAATTGTTG
CTCGAAACTGGTCGCCCCCATTGCCTTGCACTAGTGGCTGTCGGACTTTTGATGTTGGTTCTTCGATAAAGGTTGACTGAGTAGCGCGAGGCGGAGGAAA
CCCCTGTTTCGCTTGCGCTACAGCATCGAAAAGTTTTGCTTTCTGATAATCTCCAAGCAAATCAAACACACTCCCAGTTGTGCTTGTTGAACCTTCAGGC
GCTGCGGCAGAATTATCACTGCCGCTTTTTGCATCTCCTAGCAACGTGCCTCGTTGCTTCGCTGTCACAACTACTCCATTGCTGGTCTTGTCCGTCGAGA
AGTTAAACTTGCGATACAAGGCTGTAACAGCATCATCCTGgccttcatcctcgtcaaaGCGATGATATGCTTTAAAGCCTGAAGGCACAACGAGACGCAA
ATTGACTGCCTTTGGTGGTTTCTCATTCGAGGATGCAAGCTCGAATCCAGGAAGCACAGGTCGTCCATCCGAACACAGTGCCCGGCTAAGCCTTAACTTG
TCATGCCAACGATATTCTTGGGCTGACGAATCCAAGCGCTTCACATCATTCCTCGCCCCAAGAGGTGCAATCACACGATCAAACTCAGACATTGAGACGG
ATCCGTATACATCGATATCGTCGTTTTCTTCGAGCGCACTCAATCCATATCCACTGGTCGCGcggttgctgccgctggtaGACTTTAACGCGTCTAGAAA
CGACACCACCTGACGATGAGACCCATCCTTCTCTTTTAATTTCTCCTCTCGTTGTTGCTTGTGCATCGAAAACTCCGGAGCATCCGTGTACGGGTCGAAA
CCAGCTCCATACCGATCCAACTTCGGCTTTGGAAAAGATTTCTGCACATCAAACACCTTTCGTGGCGGCACATAtacctcctcttcagcctctCCTTGTG
GCTCCACCTCTACTTTCTCACCACTTGCATCTTGCATCAAAAGTTTCAATttctctccatcttcttgatgcTTGCGTCTTCGAACGCGTTGTCCGATACC
GTGACCTTCTTTCCAGCCCATTTGCTTCAGCAATTTAGCTCCAATTGAGTCGTTCACCGGTAAAACCCAGTCCTCAGGCAGTGCAAACCCTGGAATAGTT
GCAGATCcagctcgatctgcttgccgctgctgttgcagtcgtcgctttgctgctgtctgcaATGTATCATAGCGCTCCGTGGTCTCCAGTCGTTTGCCCA
GCAAtggatcgtcgtcttcgtccatgAAATCCTCCGGGCGTTGCTCCACTCTGGAAGAGCGGTTGCCTCGAGACGACGAATAGGTTTGTGGCCTCCATCC
CTCCTCACTACCTACAGAATTGTAGTATCCAGCAGAGAAGCCGCCGGTGAAGGCGCCGTGGAAGCGTCTGCGGCCTTGAGCGTCCGTCACCTACAGGGAA
AAGTGGTAAAGAACAGAAGATGAGTGTGTGGTCAATTAGAGCAGCTAATTAGAGCGTTATTTGATGCAGGAACagaggagagagagagagctaGATGTCA
CGCACCTCCTGGTTGCGAACGCCGCCGCGCTTCATTTATTGCGATTTTAGGAATGTGGTGTGGTAGACGTAACTATGGAGCCATCTTGTCAAGACACCAA
GATGGAGCCATGCACAGCTCGTCACTTTGTGGGCCTTTGTAGACGAGAACGCTGTAAGAAAAGCCATGAGCATGAAAGTCGCTGAACGTAAAGGTGATAT
AGAGACTTATCCGTGGCATCATCGATGGCTTGCGAATGACCTTCCCATTTCAATTACAATATGCATGTGGGTCTTTCAAGGCTACGGTCTACAATACCTA
GCtaggcagcagcgacgctgGATTGCGGCGGACTAGTTTGCGCTATGCAGAGCGGACACGTGAGCGACTCGTTGAGTTTGGCCAGAATGCACTCGTCGTG
GAAGCAATGGCCGCAGTTTAGAGTCGTTAGCCCCGCCCTTACGCGCTTGTCGGCCTTGTTGTACGGACCTCGTGAGCTACTGGGGGCTGCTGGTACAATT
GACACCGTGTCATCGCCGACGAGCGCCTTGCGACAGATAAAGCACTCCTCCGGATCTTGCGTCGGGTCGTTGCcaatgaagctgctgtctcGCGCTCCGA
GAGATAGTCGCTCGCTCAGCCGCGTGAAGTCCGAGCGGTCGAAGACCATGCCCTCGAACAAGAAGTCGTAGATGAGCTGCGGTAGTTTAGTCGACGACAC
GTTGCACTCAAGATTGCGGTTTTGTTTAGCCATCCGCAGTAGCGTTGAGAAGTACGTCTGCAACTCCGTAAGCCGGCCGGAGATGACACTGGGGCTTCGT
GACCGGAAGATGCGACGTCGAGGGAAGTGGTGCGCCGCATACATGTAGAGCCACGGACAGTTTGAGGAGCAGAAGTGGCCGTAGTCGAGCACACTGGCGA
TCCTCTCTTTGAGCTCGTAGAACTCCTTGAACGTCCTCGCCATCTCCCACGTCTGGTCCAGCGCGGTGTTGATGATGCGCATGACGTAGCGCGGACTCGC
CAGCTTGTTCTGACCAGGCACCACCGCCTTGACGAACTCCACGTGCACGGTGTCCAGTAGCGTCTGCTCCATCGTCTGCATGGGCGTCAGGCGCGACGAC
TGCCGCTCTACTCCACGGCGCTTGGGGAATGAGAACGATCGACTCATGCTCGCGTCCTGCTGCGACTTGCGACGCCGCAGTTTAGCGGGTGGAGCGATCG
GAAGCGAAATGGACTTCCGCAGTGCCATGGCGACGGGAACTGCTGGTCGAAAGGCGCTGCTAGCGATTGTGGGCTGCTGAACACCCGATTGTCTGTCAGC
AGAGaccaactgctccacctgGAGGCAAATTGGGTAATGTCAGCTGGCGAGTCCGATTGCACGTGTATTGCTCCAACTGGCGAGTCCAAATTGTACGAGA
TGTTGAACGCATCCCTGGATAGAGTGACGCGATGGATAGTGCCAAGCATGAAGAAAGAGCGGGACCATACATAATTTGATCATTTAACGGAGACGTTCGC
ACTACGTGATCTATAGGTCTCTACACAGAGGGATATATTGCCTCGCCACAAAACTATTATCCATCGCAAGGCTGACTACGCCAGTCGAGCTGTCGTGACG
CTCGTGCACGGTTGACGGTGCTGCATGTAGCATGTACAGTGTGGCGTTCTCCACATTGCGACGATGGCGTGGTGTGCTTCGAGCCTCTGCCATTGGGAAA
GGATTCGAACGGGACGATCGGGAGGCTACACCGATCATCACGTTCGAATCAAGTTTGCAGTTCGGACCGCTCAGGTGTTGAAGTCAAGTTCAGTACGTTT
TGCTTGGCGTACCGATATTCACCCGCCGCAGCGAAAACAGTAGGTGTATCCGTGGCAAATTCCAGGCTTTGGTGCGCACGGGCGCCTGCAACAAAACTCG
TTACGTGAAGGAGCCACCCGGTGGGGATTGCAACGGCTGGAACCGAAGTAATGAGCTTGTCGCGACTGGCGCGCACCGTGGCTGTTATAGCGAGATGCAG
CCATCTCCACGACAAAAATGCAAAGCTTTGTCGCCAACTTCGCTAATACCTGAATGACTCGCGCTTGAAACATGCTCATGTTTTCGACGGGGGGTCTCGA
TATCAGTCCTGATAACCGGGCAACAACTACAAAAGATATGTTAGACACAACTCATCTCAAGTCTGAACTCGTTCTGAAGTGGGAGAGGCGAAAACGCTCG
GCAAGTATCGCGTTTTCTTGTGGAGTCACTGCATGACGTGCCGCGCTGATCTAAGATCATGCAGTTAACTGGTTCAAAGATCAATTCGTATGAAGCTCGT
GGTGTTCATAAAATCTTATAGTGGCGAAACCAAAGCAAAACTTGCCTTGACTATTCGTCTCGTTACATCGCTGCGTAGTCCGTCTCGAATCCATCACCTG
CGCCGCTGAGGTCGGCGAAAAGGTTCGCCTCGCGCTGGAGGGCGACCGATTTCTGCCAGAAAAGCACCGCGCCGACGATAACAGCCACGAATACAGCACA
GCCAACGACGATGCCTGCAATTGCCCCACCGCTTAAGCCACCGCCGGTCGAAGCCGTGGAGTCACCTGTGTTCGCATTATCTGTGCCAACAGTAGGCGTG
CCCGAGGAGGTGCTTGCTGCCCCAGTGCTAGGAGTGGTCCCAGTCGAAGTGCTTGGCGTTTTAGACGTATTTCCGGACCCTACAGTGTCCGTTGTATCTG
CATCAGGCTCGGTTGCAGCCGGAGTCGCCGTTGGAGAGTTATTATCATAAAGCGCTGTTGGTGCAGGTGTCGGTTCACCTGCTTTACTCGGCTGAGATGG
GGTTGCTGTGGTTTCACCAGGTTCACTTGGCTTGGACGGTGACGGTGTCGGTTCACCTGGCTCAGAAGGAGTTGGCTCGCTCGAGTTTTCTGTCGGAGAT
GGAGTTGGTTCGCCGGCGGTGG