Description :
From Genome Similarity Track
Location :
Scaffold_3697:205- 2319
Sequence
2114 bases(100 bases per row)
CATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATC
CGATATGGCTGAGATTCGTATCCTCGGGATCATGGATGATCCACCTGCCCCGGCTGCGGCTGTTGCTACCACCGCCGACGACGGGGATGGGACGTCCAGA
TCATCTGGGTCGAACTCATCATGGGAGTTGTCTTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGG
GCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTTGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCTTGTGACCGTCTG
GTCCACTGGCGAACAGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCTTGGCTGGATT
GTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCC
GGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGC
GACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGAATACTATGAGATCCAGGTCTAGTT
CGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACGTGTTCGCCGTTTTCGT
TGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTTGATTCAGGATCCGCATGACAGGATCTTGATGCAGAAAATCGCGTAGAGCTTGGTGGCGA
TACACAAACTCGAGATCCTTGTCGGACGAGCTCGACCTGGACCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCG
TTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGTGCTGGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCTTTCAC
TTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGAACCTGGGGAGGATAGAGACGTTTCTCTTCTAGATCCGG
ATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCC
GACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTG
TGGTGTTGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGT
TCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTTAAGTGGTGAAGCTTGAGCGTCTTG
GCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGG
GGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTGCCTTTGTAGCTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCT
TGAAAGTTGAGAGCCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGAT
CTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGACGCTCAGTACGGCCAATGTAGTTCCGGTTCTTGAGG
GCAGGAAGGCACTT