Description :
From Genome Similarity Track
Location :
Scaffold_2955:205- 2128
Sequence
1923 bases(100 bases per row)
TTGGACCCACCGTCACTGCCGATGAAGGTGGTGGGTGGCTGTATAATGACTGCAGCACTAGGCATCTCATCGTGATGTAAATGATTGACGGCCGTCCACC
ACGGAGTCACGGTTGGGTATTGCCACCACCCCAATTAAGGTTTTAACACTACCGGTGACAGTCACTATCCGCGCTTGTATGGATGGAGTGCCCTATTTGT
TGTTTATCCAGGGGCCAGGATCTTCAATTTGACTGTTAGAGCCAACACTACATACATGCCCCGGTCCAATTGCGCATACTTACAAAAACAATTAATAGCG
TAATAACGGCGTAATAATACTCGTTATCCGTTCTTAAAAAAAGCTTTGTCAATGAGAAATGGCCCCGGCCCAAACACTGTTACGGCAGAAAGTGATGATC
CACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCCGCTTTACGGAATCAATGTG
GTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAGTGGTTGGATCCGGGAAAAGGACAGTCCAGGT
GATGGCTGTCACTAGGGTCCAGAGGAAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTTAAA
GCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCG
CTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGACCGGGATGGATTGATGAGACTGGTGATGCC
GGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGCATTGGTCGGACCTACCAACGGATCCGGGAATGTTTC
CATTGGAGAGGACTATTCAAGAGTGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGACCTACGATCGAAGGGGAGTCACCTG
GGAATATCCAAGCGACTTACCCTTTCCAGATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACGGAATTGTTGATTTGGGT
GGACCTGTTTACCGGATATGTGATTGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGG
GCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAGCCGGATCCTGGGGCAGCGACAGCGAGCAACCATGG
CATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGA
TGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCC
ACCCTAGAAGCGGCCATTCCAGTATGCAGTACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGAT
CCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTG
GCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTACTGCATGGATCGTTCCGAGTAAGTGAGAAGATAGGGGAACATGCGGTG
AAGTTTGAAACTGCAAGTACCGA